EMAIL THIS PAGE TO A FRIEND

ZNF557

zinc finger protein 557

UniProtKB ID: Q8N988, Q6PEJ3, Q9BTZ1
Gene ID:
dog(484978) zinc finger protein 557
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024341 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107591 MISSION® esiRNA esiRNA human ZNF557 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001044387 Rosetta Predictions human pricing
NM_001044388 Rosetta Predictions human pricing
NM_024341 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311342 predicted 1342
2 SASI_Hs02_00311343 predicted 1041
3 SASI_Hs02_00311344 predicted 819
4 SASI_Hs02_00311345 predicted 1563
5 SASI_Hs02_00311346 predicted 1471
6 SASI_Hs02_00311347 predicted 1300
7 SASI_Hs02_00311348 predicted 1215
8 SASI_Hs02_00311349 predicted 1050
9 SASI_Hs02_00311350 predicted 965
10 SASI_Hs02_00311351 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311352 predicted 1331
2 SASI_Hs02_00311353 predicted 1029
3 SASI_Hs02_00311354 predicted 803
4 SASI_Hs02_00311355 predicted 1553
5 SASI_Hs02_00311356 predicted 1453
6 SASI_Hs02_00311357 predicted 1293
7 SASI_Hs02_00311358 predicted 1203
8 SASI_Hs02_00311359 predicted 1039
9 SASI_Hs02_00311360 predicted 960
10 SASI_Hs02_00311361 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097309 predicted 1348
2 SASI_Hs01_00097310 predicted 1059
3 SASI_Hs01_00097311 predicted 829
4 SASI_Hs01_00097317 predicted 1574
5 SASI_Hs02_00356695 predicted 1478
6 SASI_Hs01_00097312 predicted 1311
7 SASI_Hs01_00097313 predicted 1225
8 SASI_Hs01_00097314 predicted 1062
9 SASI_Hs01_00097315 predicted 982
10 SASI_Hs01_00097316 predicted 833
11 SASI_Hs01_00097308 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024341
ZNF557 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 557
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-680s1c1
Sequence:CCGGGCAACACTCAACGAATGTAATCTCGAGATTACATTCGTTGAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1100s1c1
Sequence:CCGGGAGGGTCATTATGTATGTAATCTCGAGATTACATACATAATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-350s1c1
Sequence:CCGGCTAAAGGGCTTGGTGACCTTTCTCGAGAAAGGTCACCAAGCCCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1056s1c1
Sequence:CCGGGCACTCAGTCAATCTTCACAACTCGAGTTGTGAAGATTGACTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1233s1c1
Sequence:CCGGCGAATCTGACACAGCACATAACTCGAGTTATGTGCTGTGTCAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024341
ZNF557 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 557
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-680s1c1
Sequence:CCGGGCAACACTCAACGAATGTAATCTCGAGATTACATTCGTTGAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1100s1c1
Sequence:CCGGGAGGGTCATTATGTATGTAATCTCGAGATTACATACATAATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-350s1c1
Sequence:CCGGCTAAAGGGCTTGGTGACCTTTCTCGAGAAAGGTCACCAAGCCCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1056s1c1
Sequence:CCGGGCACTCAGTCAATCTTCACAACTCGAGTTGTGAAGATTGACTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1233s1c1
Sequence:CCGGCGAATCTGACACAGCACATAACTCGAGTTATGTGCTGTGTCAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024341
ZNF557 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 557
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-680s1c1
Sequence:CCGGGCAACACTCAACGAATGTAATCTCGAGATTACATTCGTTGAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1100s1c1
Sequence:CCGGGAGGGTCATTATGTATGTAATCTCGAGATTACATACATAATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-350s1c1
Sequence:CCGGCTAAAGGGCTTGGTGACCTTTCTCGAGAAAGGTCACCAAGCCCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1056s1c1
Sequence:CCGGGCACTCAGTCAATCTTCACAACTCGAGTTGTGAAGATTGACTGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024341.1-1233s1c1
Sequence:CCGGCGAATCTGACACAGCACATAACTCGAGTTATGTGCTGTGTCAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks