EMAIL THIS PAGE TO A FRIEND

ZNF558

zinc finger protein 558

UniProtKB ID: Q96NG5, A8K5F0
Gene ID:
dog(100686571) zinc finger protein 558
Horse(100064134) zinc finger protein 558
domestic cat(101081525) zinc finger protein 558
naked mole-rat(101698829) zinc finger protein 558
domestic guinea pig(100716772) zinc finger protein 558
cow(100335963) zinc finger protein 558
sheep(101121513) zinc finger protein 558
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112321 MISSION® esiRNA esiRNA human ZNF558 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144693 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012211 predicted 1006
2 SASI_Hs01_00012219 predicted 893
3 SASI_Hs01_00012212 predicted 575
4 SASI_Hs01_00012213 predicted 669
5 SASI_Hs01_00012214 predicted 544
6 SASI_Hs01_00012215 predicted 858
7 SASI_Hs01_00012220 predicted 887
8 SASI_Hs01_00012216 predicted 600
9 SASI_Hs01_00012218 predicted 1241
10 SASI_Hs02_00364614 predicted 1391
11 SASI_Hs01_00012217 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144693
VALIDATED
ZNF558 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 558
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-966s1c1
Sequence:CCGGCGCACCAGTTGTAACCTCAAACTCGAGTTTGAGGTTACAACTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-889s1c1
Sequence:CCGGCCTCATCCCTTAGACTGCATTCTCGAGAATGCAGTCTAAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-509s1c1
Sequence:CCGGCCAGTTGGAACAAGACAAGAACTCGAGTTCTTGTCTTGTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144693.1-669s1c1
Sequence:CCGGCGTGGAGTGAAACTCAATGAACTCGAGTTCATTGAGTTTCACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-557s21c1
Sequence:CCGGACCAAGCACCTGTCCAGATTTCTCGAGAAATCTGGACAGGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-471s21c1
Sequence:CCGGTCACTAGGGTGTCGTGTTAATCTCGAGATTAACACGACACCCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-667s21c1
Sequence:CCGGATCGTGGAGTGAAACTCAATGCTCGAGCATTGAGTTTCACTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144693.1-1502s21c1
Sequence:CCGGAGAGCTCACACTGGATATATACTCGAGTATATATCCAGTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144693
VALIDATED
ZNF558 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 558
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-966s1c1
Sequence:CCGGCGCACCAGTTGTAACCTCAAACTCGAGTTTGAGGTTACAACTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-889s1c1
Sequence:CCGGCCTCATCCCTTAGACTGCATTCTCGAGAATGCAGTCTAAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-509s1c1
Sequence:CCGGCCAGTTGGAACAAGACAAGAACTCGAGTTCTTGTCTTGTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144693.1-669s1c1
Sequence:CCGGCGTGGAGTGAAACTCAATGAACTCGAGTTCATTGAGTTTCACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-557s21c1
Sequence:CCGGACCAAGCACCTGTCCAGATTTCTCGAGAAATCTGGACAGGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-471s21c1
Sequence:CCGGTCACTAGGGTGTCGTGTTAATCTCGAGATTAACACGACACCCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-667s21c1
Sequence:CCGGATCGTGGAGTGAAACTCAATGCTCGAGCATTGAGTTTCACTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144693.1-1502s21c1
Sequence:CCGGAGAGCTCACACTGGATATATACTCGAGTATATATCCAGTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144693
VALIDATED
ZNF558 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 558
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-966s1c1
Sequence:CCGGCGCACCAGTTGTAACCTCAAACTCGAGTTTGAGGTTACAACTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-889s1c1
Sequence:CCGGCCTCATCCCTTAGACTGCATTCTCGAGAATGCAGTCTAAGGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144693.1-509s1c1
Sequence:CCGGCCAGTTGGAACAAGACAAGAACTCGAGTTCTTGTCTTGTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144693.1-669s1c1
Sequence:CCGGCGTGGAGTGAAACTCAATGAACTCGAGTTCATTGAGTTTCACTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-557s21c1
Sequence:CCGGACCAAGCACCTGTCCAGATTTCTCGAGAAATCTGGACAGGTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-471s21c1
Sequence:CCGGTCACTAGGGTGTCGTGTTAATCTCGAGATTAACACGACACCCTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144693.1-667s21c1
Sequence:CCGGATCGTGGAGTGAAACTCAATGCTCGAGCATTGAGTTTCACTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144693.1-1502s21c1
Sequence:CCGGAGAGCTCACACTGGATATATACTCGAGTATATATCCAGTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks