EMAIL THIS PAGE TO A FRIEND

ZNF559

zinc finger protein 559

Synonyms: NBLA00121
UniProtKB ID: Q9BR84, K7EMG6
Gene ID:
Horse(100060747) zinc finger protein 559
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032497 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081931 MISSION® esiRNA esiRNA human ZNF559 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218139 predicted 2155
2 SASI_Hs01_00218140 predicted 1731
3 SASI_Hs02_00359975 predicted 1906
4 SASI_Hs01_00218141 predicted 2303
5 SASI_Hs01_00218142 predicted 1438
6 SASI_Hs02_00359976 predicted 2071
7 SASI_Hs01_00218143 predicted 1585
8 SASI_Hs01_00218145 predicted 1645
9 SASI_Hs01_00218146 predicted 734
10 SASI_Hs01_00218148 predicted 799
11 SASI_Hs01_00218144 predicted 1421
12 SASI_Hs01_00218147 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032497
VALIDATED
ZNF559 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 559
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1910s21c1
Sequence:CCGGCTCATTTCTTATTCGACATTTCTCGAGAAATGTCGAATAAGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1185s21c1
Sequence:CCGGACTCAAGAGAAACCATATAAACTCGAGTTTATATGGTTTCTCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1651s21c1
Sequence:CCGGCTGATTCATCAGGTCTTATAACTCGAGTTATAAGACCTGATGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1117s1c1
Sequence:CCGGGCCAACATCTACATCTTGTTTCTCGAGAAACAAGATGTAGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1392s1c1
Sequence:CCGGCCCTTCACTGAGTCGTCATATCTCGAGATATGACGACTCAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-1244s1c1
Sequence:CCGGCCTCAGAGAATGTGTAAGAATCTCGAGATTCTTACACATTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-737s1c1
Sequence:CCGGGCTGGATCAAACTCAGAGAAACTCGAGTTTCTCTGAGTTTGATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-2083s1c1
Sequence:CCGGGCCTTACAGTACACATGAGAACTCGAGTTCTCATGTGTACTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032497
VALIDATED
ZNF559 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 559
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1910s21c1
Sequence:CCGGCTCATTTCTTATTCGACATTTCTCGAGAAATGTCGAATAAGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1185s21c1
Sequence:CCGGACTCAAGAGAAACCATATAAACTCGAGTTTATATGGTTTCTCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1651s21c1
Sequence:CCGGCTGATTCATCAGGTCTTATAACTCGAGTTATAAGACCTGATGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1117s1c1
Sequence:CCGGGCCAACATCTACATCTTGTTTCTCGAGAAACAAGATGTAGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1392s1c1
Sequence:CCGGCCCTTCACTGAGTCGTCATATCTCGAGATATGACGACTCAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-1244s1c1
Sequence:CCGGCCTCAGAGAATGTGTAAGAATCTCGAGATTCTTACACATTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-737s1c1
Sequence:CCGGGCTGGATCAAACTCAGAGAAACTCGAGTTTCTCTGAGTTTGATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-2083s1c1
Sequence:CCGGGCCTTACAGTACACATGAGAACTCGAGTTCTCATGTGTACTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032497
VALIDATED
ZNF559 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 559
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1910s21c1
Sequence:CCGGCTCATTTCTTATTCGACATTTCTCGAGAAATGTCGAATAAGAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1185s21c1
Sequence:CCGGACTCAAGAGAAACCATATAAACTCGAGTTTATATGGTTTCTCTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032497.1-1651s21c1
Sequence:CCGGCTGATTCATCAGGTCTTATAACTCGAGTTATAAGACCTGATGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1117s1c1
Sequence:CCGGGCCAACATCTACATCTTGTTTCTCGAGAAACAAGATGTAGATGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032497.1-1392s1c1
Sequence:CCGGCCCTTCACTGAGTCGTCATATCTCGAGATATGACGACTCAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-1244s1c1
Sequence:CCGGCCTCAGAGAATGTGTAAGAATCTCGAGATTCTTACACATTCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-737s1c1
Sequence:CCGGGCTGGATCAAACTCAGAGAAACTCGAGTTTCTCTGAGTTTGATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032497.1-2083s1c1
Sequence:CCGGGCCTTACAGTACACATGAGAACTCGAGTTCTCATGTGTACTGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks