EMAIL THIS PAGE TO A FRIEND

ZNF560

zinc finger protein 560

Species: Human ZNF560(147741)
UniProtKB ID: Q96MR9, Q495S9, Q495T1
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057244 predicted 2213
2 SASI_Hs01_00057245 predicted 1049
3 SASI_Hs01_00057246 predicted 1444
4 SASI_Hs02_00366251 predicted 2299
5 SASI_Hs01_00057247 predicted 2034
6 SASI_Hs01_00057248 predicted 2254
7 SASI_Hs01_00057249 predicted 1818
8 SASI_Hs01_00057250 predicted 2546
9 SASI_Hs01_00057251 predicted 1471
10 SASI_Hs01_00057252 predicted 1430
11 SASI_Hs01_00057243 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152476
ZNF560 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 560
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1877s1c1
Sequence:CCGGGCTCATATCTTACCAAACATTCTCGAGAATGTTTGGTAAGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-2554s1c1
Sequence:CCGGGCTCGTATTGCACATTTGAAACTCGAGTTTCAAATGTGCAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1211s1c1
Sequence:CCGGGCCATGCTGTAAATGTTGAAACTCGAGTTTCAACATTTACAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1372s1c1
Sequence:CCGGCCGTCAGGCTTTCTTGAACATCTCGAGATGTTCAAGAAAGCCTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-303s1c1
Sequence:CCGGCCCAGTTCAGAGAAACTTATACTCGAGTATAAGTTTCTCTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-1619s21c1
Sequence:CCGGGTACATCCTCAGGTGTTATTGCTCGAGCAATAACACCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2301s21c1
Sequence:CCGGGTGCTTTCATGATCGCTTAAACTCGAGTTTAAGCGATCATGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2459s21c1
Sequence:CCGGGTACATCCTCAGGACGTATTCCTCGAGGAATACGTCCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152476
ZNF560 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 560
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1877s1c1
Sequence:CCGGGCTCATATCTTACCAAACATTCTCGAGAATGTTTGGTAAGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-2554s1c1
Sequence:CCGGGCTCGTATTGCACATTTGAAACTCGAGTTTCAAATGTGCAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1211s1c1
Sequence:CCGGGCCATGCTGTAAATGTTGAAACTCGAGTTTCAACATTTACAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1372s1c1
Sequence:CCGGCCGTCAGGCTTTCTTGAACATCTCGAGATGTTCAAGAAAGCCTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-303s1c1
Sequence:CCGGCCCAGTTCAGAGAAACTTATACTCGAGTATAAGTTTCTCTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-1619s21c1
Sequence:CCGGGTACATCCTCAGGTGTTATTGCTCGAGCAATAACACCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2301s21c1
Sequence:CCGGGTGCTTTCATGATCGCTTAAACTCGAGTTTAAGCGATCATGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2459s21c1
Sequence:CCGGGTACATCCTCAGGACGTATTCCTCGAGGAATACGTCCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152476
ZNF560 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 560
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1877s1c1
Sequence:CCGGGCTCATATCTTACCAAACATTCTCGAGAATGTTTGGTAAGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-2554s1c1
Sequence:CCGGGCTCGTATTGCACATTTGAAACTCGAGTTTCAAATGTGCAATACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1211s1c1
Sequence:CCGGGCCATGCTGTAAATGTTGAAACTCGAGTTTCAACATTTACAGCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-1372s1c1
Sequence:CCGGCCGTCAGGCTTTCTTGAACATCTCGAGATGTTCAAGAAAGCCTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152476.1-303s1c1
Sequence:CCGGCCCAGTTCAGAGAAACTTATACTCGAGTATAAGTTTCTCTGAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-1619s21c1
Sequence:CCGGGTACATCCTCAGGTGTTATTGCTCGAGCAATAACACCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2301s21c1
Sequence:CCGGGTGCTTTCATGATCGCTTAAACTCGAGTTTAAGCGATCATGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152476.2-2459s21c1
Sequence:CCGGGTACATCCTCAGGACGTATTCCTCGAGGAATACGTCCTGAGGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks