EMAIL THIS PAGE TO A FRIEND

ZNF561

zinc finger protein 561

Species: Human ZNF561(93134)
UniProtKB ID: Q8N587, Q6PJS0
Gene ID:
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152289 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152289 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152473 predicted 748
2 SASI_Hs02_00365845 predicted 1154
3 SASI_Hs02_00365846 predicted 625
4 SASI_Hs02_00365847 predicted 898
5 SASI_Hs01_00152476 predicted 616
6 SASI_Hs01_00152474 predicted 1252
7 SASI_Hs01_00152475 predicted 925
8 SASI_Hs01_00152477 predicted 634
9 SASI_Hs01_00152478 predicted 678
10 SASI_Hs01_00152479 predicted 605
11 SASI_Hs01_00152480 predicted 859
12 SASI_Hs01_00152481 predicted 693
13 SASI_Hs01_00152482 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152289
VALIDATED
ZNF561 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 561
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-540s21c1
Sequence:CCGGTGGAAACTCTGTGACTGTAAGCTCGAGCTTACAGTCACAGAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1319s21c1
Sequence:CCGGCACTACATCCACAAGTCTTATCTCGAGATAAGACTTGTGGATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1631s21c1
Sequence:GTACCGGATGCAAGGATATGAGTGTTACCTCGAGGTAACACTCATATCCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152289.1-3127s21c1
Sequence:CCGGCTTCGTATCAAGGGTTGTATTCTCGAGAATACAACCCTTGATACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152289.1-1078s21c1
Sequence:CCGGCATGCCTTAATGATCACATTCCTCGAGGAATGTGATCATTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152289.1-3248s1c1
Sequence:CCGGGCCTCATTTGTCAGTTTCAAACTCGAGTTTGAAACTGACAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1081s1c1
Sequence:CCGGGCCTTAATGATCACATTCAAACTCGAGTTTGAATGTGATCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-512s1c1
Sequence:CCGGGATACAAATGACAAGAGGCTACTCGAGTAGCCTCTTGTCATTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1333s1c1
Sequence:CCGGGTCTTATTCAGCATACAAGAACTCGAGTTCTTGTATGCTGAATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1330s1c1
Sequence:CCGGCAAGTCTTATTCAGCATACAACTCGAGTTGTATGCTGAATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152289
VALIDATED
ZNF561 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 561
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-540s21c1
Sequence:CCGGTGGAAACTCTGTGACTGTAAGCTCGAGCTTACAGTCACAGAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1319s21c1
Sequence:CCGGCACTACATCCACAAGTCTTATCTCGAGATAAGACTTGTGGATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1631s21c1
Sequence:GTACCGGATGCAAGGATATGAGTGTTACCTCGAGGTAACACTCATATCCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152289.1-3127s21c1
Sequence:CCGGCTTCGTATCAAGGGTTGTATTCTCGAGAATACAACCCTTGATACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152289.1-1078s21c1
Sequence:CCGGCATGCCTTAATGATCACATTCCTCGAGGAATGTGATCATTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152289.1-3248s1c1
Sequence:CCGGGCCTCATTTGTCAGTTTCAAACTCGAGTTTGAAACTGACAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1081s1c1
Sequence:CCGGGCCTTAATGATCACATTCAAACTCGAGTTTGAATGTGATCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-512s1c1
Sequence:CCGGGATACAAATGACAAGAGGCTACTCGAGTAGCCTCTTGTCATTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1333s1c1
Sequence:CCGGGTCTTATTCAGCATACAAGAACTCGAGTTCTTGTATGCTGAATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1330s1c1
Sequence:CCGGCAAGTCTTATTCAGCATACAACTCGAGTTGTATGCTGAATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152289
VALIDATED
ZNF561 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 561
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-540s21c1
Sequence:CCGGTGGAAACTCTGTGACTGTAAGCTCGAGCTTACAGTCACAGAGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1319s21c1
Sequence:CCGGCACTACATCCACAAGTCTTATCTCGAGATAAGACTTGTGGATGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152289.1-1631s21c1
Sequence:GTACCGGATGCAAGGATATGAGTGTTACCTCGAGGTAACACTCATATCCTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152289.1-3127s21c1
Sequence:CCGGCTTCGTATCAAGGGTTGTATTCTCGAGAATACAACCCTTGATACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152289.1-1078s21c1
Sequence:CCGGCATGCCTTAATGATCACATTCCTCGAGGAATGTGATCATTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152289.1-3248s1c1
Sequence:CCGGGCCTCATTTGTCAGTTTCAAACTCGAGTTTGAAACTGACAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1081s1c1
Sequence:CCGGGCCTTAATGATCACATTCAAACTCGAGTTTGAATGTGATCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-512s1c1
Sequence:CCGGGATACAAATGACAAGAGGCTACTCGAGTAGCCTCTTGTCATTTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1333s1c1
Sequence:CCGGGTCTTATTCAGCATACAAGAACTCGAGTTCTTGTATGCTGAATAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152289.1-1330s1c1
Sequence:CCGGCAAGTCTTATTCAGCATACAACTCGAGTTGTATGCTGAATAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks