EMAIL THIS PAGE TO A FRIEND

ZNF562

zinc finger protein 562

Species: Human ZNF562(54811)
UniProtKB ID: Q6V9R5, Q32MN2, Q9NXS5
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017656 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121601 MISSION® esiRNA esiRNA human ZNF562 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017656 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108339 predicted 326
2 SASI_Hs01_00108341 predicted 317
3 SASI_Hs01_00108342 predicted 506
4 SASI_Hs01_00108345 predicted 776
5 SASI_Hs02_00350364 predicted 659
6 SASI_Hs02_00350365 predicted 288
7 SASI_Hs02_00350366 predicted 647
8 SASI_Hs02_00350367 predicted 181
9 SASI_Hs02_00350368 predicted 1229
10 SASI_Hs01_00108338 predicted 860
11 SASI_Hs01_00108340 predicted 455
12 SASI_Hs01_00108343 predicted 615
13 SASI_Hs01_00108344 predicted 648
14 SASI_Hs01_00108346 predicted 382
15 SASI_Hs01_00108347 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017656
ZNF562 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 562
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-212s1c1
Sequence:CCGGGCTTAACTTCAGAATGGGAAACTCGAGTTTCCCATTCTGAAGTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1197s1c1
Sequence:CCGGCCATCGTAGTAAACATTTGAACTCGAGTTCAAATGTTTACTACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1094s1c1
Sequence:CCGGGAGCCTTCAATAGATCTTCAACTCGAGTTGAAGATCTATTGAAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-293s1c1
Sequence:CCGGCTGGGATACAAATGCAGACAACTCGAGTTGTCTGCATTTGTATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-678s1c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1143s21c1
Sequence:CCGGCAATAGATCTTCAACGCTTACCTCGAGGTAAGCGTTGAAGATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1263s21c1
Sequence:CCGGTCACAGTGGAGAAAGGTAAATCTCGAGATTTACCTTTCTCCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017656.3-1450s21c1
Sequence:CCGGTATGAGTGTTGTTACCATTTACTCGAGTAAATGGTAACAACACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-720s21c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-570s21c1
Sequence:CCGGCCTTGCTGTGCATCTTGAAATCTCGAGATTTCAAGATGCACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017656
ZNF562 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 562
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-212s1c1
Sequence:CCGGGCTTAACTTCAGAATGGGAAACTCGAGTTTCCCATTCTGAAGTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1197s1c1
Sequence:CCGGCCATCGTAGTAAACATTTGAACTCGAGTTCAAATGTTTACTACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1094s1c1
Sequence:CCGGGAGCCTTCAATAGATCTTCAACTCGAGTTGAAGATCTATTGAAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-293s1c1
Sequence:CCGGCTGGGATACAAATGCAGACAACTCGAGTTGTCTGCATTTGTATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-678s1c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1143s21c1
Sequence:CCGGCAATAGATCTTCAACGCTTACCTCGAGGTAAGCGTTGAAGATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1263s21c1
Sequence:CCGGTCACAGTGGAGAAAGGTAAATCTCGAGATTTACCTTTCTCCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017656.3-1450s21c1
Sequence:CCGGTATGAGTGTTGTTACCATTTACTCGAGTAAATGGTAACAACACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-720s21c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-570s21c1
Sequence:CCGGCCTTGCTGTGCATCTTGAAATCTCGAGATTTCAAGATGCACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017656
ZNF562 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 562
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-212s1c1
Sequence:CCGGGCTTAACTTCAGAATGGGAAACTCGAGTTTCCCATTCTGAAGTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1197s1c1
Sequence:CCGGCCATCGTAGTAAACATTTGAACTCGAGTTCAAATGTTTACTACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-1094s1c1
Sequence:CCGGGAGCCTTCAATAGATCTTCAACTCGAGTTGAAGATCTATTGAAGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-293s1c1
Sequence:CCGGCTGGGATACAAATGCAGACAACTCGAGTTGTCTGCATTTGTATCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017656.1-678s1c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1143s21c1
Sequence:CCGGCAATAGATCTTCAACGCTTACCTCGAGGTAAGCGTTGAAGATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-1263s21c1
Sequence:CCGGTCACAGTGGAGAAAGGTAAATCTCGAGATTTACCTTTCTCCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017656.3-1450s21c1
Sequence:CCGGTATGAGTGTTGTTACCATTTACTCGAGTAAATGGTAACAACACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-720s21c1
Sequence:CCGGCATCACAACTTCCTCACACTTCTCGAGAAGTGTGAGGAAGTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017656.3-570s21c1
Sequence:CCGGCCTTGCTGTGCATCTTGAAATCTCGAGATTTCAAGATGCACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks