EMAIL THIS PAGE TO A FRIEND

ZNF563

zinc finger protein 563

Species: Human ZNF563(147837)
UniProtKB ID: Q8TA94, B2R9E7, Q8NAT7
Gene ID:
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128191 MISSION® esiRNA esiRNA human ZNF563 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145276 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078630 predicted 401
2 SASI_Hs01_00078631 predicted 1420
3 SASI_Hs01_00078632 predicted 1236
4 SASI_Hs01_00078633 predicted 1244
5 SASI_Hs01_00078634 predicted 324
6 SASI_Hs01_00078635 predicted 405
7 SASI_Hs01_00078636 predicted 333
8 SASI_Hs01_00078637 predicted 548
9 SASI_Hs01_00078638 predicted 780
10 SASI_Hs01_00078639 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145276
ZNF563 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 563
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-446s1c1
Sequence:CCGGTGGAGAAACATTTAGCCTCATCTCGAGATGAGGCTAAATGTTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1576s1c1
Sequence:CCGGCCTTTGTTTATCCCAGTGTATCTCGAGATACACTGGGATAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-776s1c1
Sequence:CCGGGCAAGGTGGAAATAGACCTTACTCGAGTAAGGTCTATTTCCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1248s1c1
Sequence:CCGGCGTCCCAGTTTAGTTCGATATCTCGAGATATCGAACTAAACTGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-521s1c1
Sequence:CCGGCGCTGAGTGTGAAGAAGTCATCTCGAGATGACTTCTTCACACTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145276
ZNF563 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 563
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-446s1c1
Sequence:CCGGTGGAGAAACATTTAGCCTCATCTCGAGATGAGGCTAAATGTTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1576s1c1
Sequence:CCGGCCTTTGTTTATCCCAGTGTATCTCGAGATACACTGGGATAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-776s1c1
Sequence:CCGGGCAAGGTGGAAATAGACCTTACTCGAGTAAGGTCTATTTCCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1248s1c1
Sequence:CCGGCGTCCCAGTTTAGTTCGATATCTCGAGATATCGAACTAAACTGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-521s1c1
Sequence:CCGGCGCTGAGTGTGAAGAAGTCATCTCGAGATGACTTCTTCACACTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145276
ZNF563 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 563
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-446s1c1
Sequence:CCGGTGGAGAAACATTTAGCCTCATCTCGAGATGAGGCTAAATGTTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1576s1c1
Sequence:CCGGCCTTTGTTTATCCCAGTGTATCTCGAGATACACTGGGATAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-776s1c1
Sequence:CCGGGCAAGGTGGAAATAGACCTTACTCGAGTAAGGTCTATTTCCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-1248s1c1
Sequence:CCGGCGTCCCAGTTTAGTTCGATATCTCGAGATATCGAACTAAACTGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145276.1-521s1c1
Sequence:CCGGCGCTGAGTGTGAAGAAGTCATCTCGAGATGACTTCTTCACACTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks