EMAIL THIS PAGE TO A FRIEND

ZNF564

zinc finger protein 564

Species: Human ZNF564(163050)
UniProtKB ID: Q8TBZ8, B9EGT4, Q6P1K6
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36149 Anti-ZNF564 (AB1) antibody produced in rabbit affinity isolated antibody horse, bovine, human
western blot pricing
AV39839 Anti-ZNF564 (AB2) antibody produced in rabbit affinity isolated antibody pig, human, mouse, canine, guinea pig, zebrafish, rat, horse, bovine
western blot pricing
HPA043998 Anti-ZNF564 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144976 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144976 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102490 predicted 1212
2 SASI_Hs01_00102491 predicted 376
3 SASI_Hs01_00102492 predicted 1210
4 SASI_Hs01_00102493 predicted 791
5 SASI_Hs01_00102494 predicted 530
6 SASI_Hs01_00102495 predicted 450
7 SASI_Hs01_00102496 predicted 666
8 SASI_Hs01_00102498 predicted 620
9 SASI_Hs01_00102499 predicted 1524
10 SASI_Hs02_00364777 predicted 547
11 SASI_Hs01_00102497 predicted 1631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144976
ZNF564 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 564
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-769s1c1
Sequence:CCGGCGCCCAAGTTTATTTCAGATACTCGAGTATCTGAAATAAACTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-398s1c1
Sequence:CCGGTCAGTCAGATTCTCAATCTTACTCGAGTAAGATTGAGAATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1108s1c1
Sequence:CCGGCCCAGTTATGTTCGAAAGCATCTCGAGATGCTTTCGAACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1528s1c1
Sequence:CCGGCCTAGTTCTGTCCGAACACATCTCGAGATGTGTTCGGACAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-457s1c1
Sequence:CCGGGAATGTAGTTTGTGTGGGAAACTCGAGTTTCCCACACAAACTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144976.3-2089s21c1
Sequence:CCGGGAATTGAGTCTCATCCATATCCTCGAGGATATGGATGAGACTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144976.3-1835s21c1
Sequence:CCGGTTATCACACAACCTTCGAATACTCGAGTATTCGAAGGTTGTGTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144976
ZNF564 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 564
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-769s1c1
Sequence:CCGGCGCCCAAGTTTATTTCAGATACTCGAGTATCTGAAATAAACTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-398s1c1
Sequence:CCGGTCAGTCAGATTCTCAATCTTACTCGAGTAAGATTGAGAATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1108s1c1
Sequence:CCGGCCCAGTTATGTTCGAAAGCATCTCGAGATGCTTTCGAACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1528s1c1
Sequence:CCGGCCTAGTTCTGTCCGAACACATCTCGAGATGTGTTCGGACAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-457s1c1
Sequence:CCGGGAATGTAGTTTGTGTGGGAAACTCGAGTTTCCCACACAAACTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144976.3-2089s21c1
Sequence:CCGGGAATTGAGTCTCATCCATATCCTCGAGGATATGGATGAGACTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144976.3-1835s21c1
Sequence:CCGGTTATCACACAACCTTCGAATACTCGAGTATTCGAAGGTTGTGTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144976
ZNF564 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 564
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-769s1c1
Sequence:CCGGCGCCCAAGTTTATTTCAGATACTCGAGTATCTGAAATAAACTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-398s1c1
Sequence:CCGGTCAGTCAGATTCTCAATCTTACTCGAGTAAGATTGAGAATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1108s1c1
Sequence:CCGGCCCAGTTATGTTCGAAAGCATCTCGAGATGCTTTCGAACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-1528s1c1
Sequence:CCGGCCTAGTTCTGTCCGAACACATCTCGAGATGTGTTCGGACAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144976.1-457s1c1
Sequence:CCGGGAATGTAGTTTGTGTGGGAAACTCGAGTTTCCCACACAAACTACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144976.3-2089s21c1
Sequence:CCGGGAATTGAGTCTCATCCATATCCTCGAGGATATGGATGAGACTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144976.3-1835s21c1
Sequence:CCGGTTATCACACAACCTTCGAATACTCGAGTATTCGAAGGTTGTGTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks