EMAIL THIS PAGE TO A FRIEND

ZNF565

zinc finger protein 565

UniProtKB ID: Q8N9K5, Q6NUS2
Gene ID:
chicken(430205) zinc finger protein 565
Horse(100060625) zinc finger protein 565
domestic cat(101100525) zinc finger protein 565
dog(611742) zinc finger protein 565
cow(538504) zinc finger protein 565
sheep(101115223) zinc finger protein 565
domestic guinea pig(100714840) zinc finger protein 565
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042474 Rosetta Predictions human pricing
NM_152477 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310018 predicted 624
2 SASI_Hs02_00310019 predicted 541
3 SASI_Hs02_00310020 predicted 1658
4 SASI_Hs02_00310021 predicted 457
5 SASI_Hs02_00310022 predicted 680
6 SASI_Hs02_00310023 predicted 744
7 SASI_Hs02_00310024 predicted 571
8 SASI_Hs02_00310025 predicted 1449
9 SASI_Hs02_00310026 predicted 1452
10 SASI_Hs02_00310027 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105617 predicted 473
2 SASI_Hs01_00105619 predicted 392
3 SASI_Hs01_00105620 predicted 1501
4 SASI_Hs01_00105621 predicted 305
5 SASI_Hs01_00105622 predicted 532
6 SASI_Hs01_00105624 predicted 596
7 SASI_Hs01_00105625 predicted 412
8 SASI_Hs01_00105626 predicted 1302
9 SASI_Hs02_00366252 predicted 1294
10 SASI_Hs02_00366253 predicted 799
11 SASI_Hs01_00105618 predicted 258
12 SASI_Hs01_00105623 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152477
ZNF565 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 565
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-394s21c1
Sequence:CCGGGCATTCAACTGGGAGATAATGCTCGAGCATTATCTCCCAGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1562s21c1
Sequence:CCGGTTCTTGGCTCACAACTCATTGCTCGAGCAATGAGTTGTGAGCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-261s21c1
Sequence:CCGGGCCTGATGTCGTCTCCTTATTCTCGAGAATAAGGAGACGACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-522s21c1
Sequence:CCGGGAACGTCACCTATGGACATATCTCGAGATATGTCCATAGGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1266s21c1
Sequence:CCGGTGGCGACAGACCCTATGAATGCTCGAGCATTCATAGGGTCTGTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1507s1c1
Sequence:CCGGCCTGGTATCAAACCTTACGAACTCGAGTTCGTAAGGTTTGATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-795s1c1
Sequence:CCGGTGGTCGTACATCAGAACTTATCTCGAGATAAGTTCTGATGTACGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1471s1c1
Sequence:CCGGCGTAGTTCACAACTTACCGAACTCGAGTTCGGTAAGTTGTGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-289s1c1
Sequence:CCGGCCCTGGATGATTGCAAATGATCTCGAGATCATTTGCAATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-468s1c1
Sequence:CCGGCCAGTTTGAGAGACAAGTCAACTCGAGTTGACTTGTCTCTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152477
ZNF565 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 565
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-394s21c1
Sequence:CCGGGCATTCAACTGGGAGATAATGCTCGAGCATTATCTCCCAGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1562s21c1
Sequence:CCGGTTCTTGGCTCACAACTCATTGCTCGAGCAATGAGTTGTGAGCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-261s21c1
Sequence:CCGGGCCTGATGTCGTCTCCTTATTCTCGAGAATAAGGAGACGACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-522s21c1
Sequence:CCGGGAACGTCACCTATGGACATATCTCGAGATATGTCCATAGGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1266s21c1
Sequence:CCGGTGGCGACAGACCCTATGAATGCTCGAGCATTCATAGGGTCTGTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1507s1c1
Sequence:CCGGCCTGGTATCAAACCTTACGAACTCGAGTTCGTAAGGTTTGATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-795s1c1
Sequence:CCGGTGGTCGTACATCAGAACTTATCTCGAGATAAGTTCTGATGTACGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1471s1c1
Sequence:CCGGCGTAGTTCACAACTTACCGAACTCGAGTTCGGTAAGTTGTGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-289s1c1
Sequence:CCGGCCCTGGATGATTGCAAATGATCTCGAGATCATTTGCAATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-468s1c1
Sequence:CCGGCCAGTTTGAGAGACAAGTCAACTCGAGTTGACTTGTCTCTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152477
ZNF565 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 565
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-394s21c1
Sequence:CCGGGCATTCAACTGGGAGATAATGCTCGAGCATTATCTCCCAGTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1562s21c1
Sequence:CCGGTTCTTGGCTCACAACTCATTGCTCGAGCAATGAGTTGTGAGCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-261s21c1
Sequence:CCGGGCCTGATGTCGTCTCCTTATTCTCGAGAATAAGGAGACGACATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-522s21c1
Sequence:CCGGGAACGTCACCTATGGACATATCTCGAGATATGTCCATAGGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152477.3-1266s21c1
Sequence:CCGGTGGCGACAGACCCTATGAATGCTCGAGCATTCATAGGGTCTGTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1507s1c1
Sequence:CCGGCCTGGTATCAAACCTTACGAACTCGAGTTCGTAAGGTTTGATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-795s1c1
Sequence:CCGGTGGTCGTACATCAGAACTTATCTCGAGATAAGTTCTGATGTACGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-1471s1c1
Sequence:CCGGCGTAGTTCACAACTTACCGAACTCGAGTTCGGTAAGTTGTGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-289s1c1
Sequence:CCGGCCCTGGATGATTGCAAATGATCTCGAGATCATTTGCAATCATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152477.2-468s1c1
Sequence:CCGGCCAGTTTGAGAGACAAGTCAACTCGAGTTGACTTGTCTCTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks