EMAIL THIS PAGE TO A FRIEND

ZNF566

zinc finger protein 566

UniProtKB ID: Q969W8, B7ZL95, Q2M3J1
Gene ID:
domestic guinea pig(100716249) zinc finger protein 566
cow(767945) zinc finger protein 566
sheep(101122457) zinc finger protein 566
domestic cat(101084843) zinc finger protein 566
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032838 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093541 MISSION® esiRNA esiRNA human ZNF566 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032838 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244150 predicted 1407
2 SASI_Hs02_00360435 predicted 1286
3 SASI_Hs01_00244151 predicted 1045
4 SASI_Hs01_00244152 predicted 371
5 SASI_Hs01_00244153 predicted 663
6 SASI_Hs01_00244154 predicted 448
7 SASI_Hs01_00244155 predicted 690
8 SASI_Hs01_00244156 predicted 1215
9 SASI_Hs01_00244157 predicted 1208
10 SASI_Hs01_00244158 predicted 1329
11 SASI_Hs01_00244159 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032838
ZNF566 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 566
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-713s1c1
Sequence:CCGGCCCTCAAGACTCACTCATCATCTCGAGATGATGAGTGAGTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-1221s1c1
Sequence:CCGGCACAGCTTATTAGTCATCATACTCGAGTATGATGACTAATAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-446s1c1
Sequence:CCGGTGGGAATGTAATAGGCAGTTTCTCGAGAAACTGCCTATTACATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-553s1c1
Sequence:CCGGCTTCACATTACAGCAAATCATCTCGAGATGATTTGCTGTAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-663s1c1
Sequence:CCGGCCATTGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1664s21c1
Sequence:CCGGGTAGTCCTGTGATTGTCATTTCTCGAGAAATGACAATCACAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1555s21c1
Sequence:CCGGGATAATTCAGTCTAGCAATATCTCGAGATATTGCTAGACTGAATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1513s21c1
Sequence:CCGGCTTTGGAAGCCCTTAACTAAACTCGAGTTTAGTTAAGGGCTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032838
ZNF566 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 566
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-713s1c1
Sequence:CCGGCCCTCAAGACTCACTCATCATCTCGAGATGATGAGTGAGTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-1221s1c1
Sequence:CCGGCACAGCTTATTAGTCATCATACTCGAGTATGATGACTAATAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-446s1c1
Sequence:CCGGTGGGAATGTAATAGGCAGTTTCTCGAGAAACTGCCTATTACATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-553s1c1
Sequence:CCGGCTTCACATTACAGCAAATCATCTCGAGATGATTTGCTGTAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-663s1c1
Sequence:CCGGCCATTGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1664s21c1
Sequence:CCGGGTAGTCCTGTGATTGTCATTTCTCGAGAAATGACAATCACAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1555s21c1
Sequence:CCGGGATAATTCAGTCTAGCAATATCTCGAGATATTGCTAGACTGAATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1513s21c1
Sequence:CCGGCTTTGGAAGCCCTTAACTAAACTCGAGTTTAGTTAAGGGCTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032838
ZNF566 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 566
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-713s1c1
Sequence:CCGGCCCTCAAGACTCACTCATCATCTCGAGATGATGAGTGAGTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-1221s1c1
Sequence:CCGGCACAGCTTATTAGTCATCATACTCGAGTATGATGACTAATAAGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-446s1c1
Sequence:CCGGTGGGAATGTAATAGGCAGTTTCTCGAGAAACTGCCTATTACATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-553s1c1
Sequence:CCGGCTTCACATTACAGCAAATCATCTCGAGATGATTTGCTGTAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032838.2-663s1c1
Sequence:CCGGCCATTGAGAAGCCTTATGAATCTCGAGATTCATAAGGCTTCTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1664s21c1
Sequence:CCGGGTAGTCCTGTGATTGTCATTTCTCGAGAAATGACAATCACAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1555s21c1
Sequence:CCGGGATAATTCAGTCTAGCAATATCTCGAGATATTGCTAGACTGAATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032838.4-1513s21c1
Sequence:CCGGCTTTGGAAGCCCTTAACTAAACTCGAGTTTAGTTAAGGGCTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks