EMAIL THIS PAGE TO A FRIEND

ZNF567

zinc finger protein 567

UniProtKB ID: Q8N184, B3KX49, Q6N044
Gene ID:
chicken(768595) zinc finger protein 567
Horse(100060796) zinc finger protein 567
domestic cat(101086021) zinc finger protein 567
dog(484561) zinc finger protein 567
cow(532421) zinc finger protein 567
sheep(101103664) zinc finger protein 567
domestic guinea pig(100715123) zinc finger protein 567
naked mole-rat(101723411) zinc finger protein 567
Domestic Rabbit(100357272) zinc finger protein 567
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152603 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145261 MISSION® esiRNA esiRNA human ZNF567 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152603 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062145 predicted 1612
2 SASI_Hs01_00062146 predicted 1175
3 SASI_Hs01_00062147 predicted 274
4 SASI_Hs01_00062148 predicted 239
5 SASI_Hs01_00062149 predicted 1561
6 SASI_Hs01_00062150 predicted 1562
7 SASI_Hs02_00366449 predicted 299
8 SASI_Hs01_00062151 predicted 595
9 SASI_Hs02_00366450 predicted 2032
10 SASI_Hs01_00062152 predicted 358
11 SASI_Hs01_00062153 predicted 515
12 SASI_Hs01_00062154 predicted 1808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152603
VALIDATED
ZNF567 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 567
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-1956s21c1
Sequence:CCGGGGTAAGTCTTTCAGTTATAAGCTCGAGCTTATAACTGAAAGACTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-954s21c1
Sequence:CCGGGCATTTAGAAGGAAATCATATCTCGAGATATGATTTCCTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-559s21c1
Sequence:CCGGAGAGACTTAGTGAGTATAATGCTCGAGCATTATACTCACTAAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-587s21c1
Sequence:CCGGGAAATCACTCCTGAGTACTAACTCGAGTTAGTACTCAGGAGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152603.2-2428s21c1
Sequence:CCGGACCACTTCCGTAGCCTATAACCTCGAGGTTATAGGCTACGGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-284s21c1
Sequence:CCGGGACATCATTTGCAGGTCATACCTCGAGGTATGACCTGCAAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1756s1c1
Sequence:CCGGCCGGCCAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_152603.2-651s1c1
Sequence:CCGGGCCAGAGCTTTCAGTCATAATCTCGAGATTATGACTGAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-733s1c1
Sequence:CCGGGTGAGAAATCATTCCTTCAAACTCGAGTTTGAAGGAATGATTTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-480s1c1
Sequence:CCGGCCTCCTGAATATGATACTCATCTCGAGATGAGTATCATATTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1883s1c1
Sequence:CCGGCCGCCAGAAGACAAATCTTATCTCGAGATAAGATTTGTCTTCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152603
VALIDATED
ZNF567 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 567
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-1956s21c1
Sequence:CCGGGGTAAGTCTTTCAGTTATAAGCTCGAGCTTATAACTGAAAGACTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-954s21c1
Sequence:CCGGGCATTTAGAAGGAAATCATATCTCGAGATATGATTTCCTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-559s21c1
Sequence:CCGGAGAGACTTAGTGAGTATAATGCTCGAGCATTATACTCACTAAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-587s21c1
Sequence:CCGGGAAATCACTCCTGAGTACTAACTCGAGTTAGTACTCAGGAGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152603.2-2428s21c1
Sequence:CCGGACCACTTCCGTAGCCTATAACCTCGAGGTTATAGGCTACGGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-284s21c1
Sequence:CCGGGACATCATTTGCAGGTCATACCTCGAGGTATGACCTGCAAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1756s1c1
Sequence:CCGGCCGGCCAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_152603.2-651s1c1
Sequence:CCGGGCCAGAGCTTTCAGTCATAATCTCGAGATTATGACTGAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-733s1c1
Sequence:CCGGGTGAGAAATCATTCCTTCAAACTCGAGTTTGAAGGAATGATTTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-480s1c1
Sequence:CCGGCCTCCTGAATATGATACTCATCTCGAGATGAGTATCATATTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1883s1c1
Sequence:CCGGCCGCCAGAAGACAAATCTTATCTCGAGATAAGATTTGTCTTCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152603
VALIDATED
ZNF567 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 567
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-1956s21c1
Sequence:CCGGGGTAAGTCTTTCAGTTATAAGCTCGAGCTTATAACTGAAAGACTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-954s21c1
Sequence:CCGGGCATTTAGAAGGAAATCATATCTCGAGATATGATTTCCTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-559s21c1
Sequence:CCGGAGAGACTTAGTGAGTATAATGCTCGAGCATTATACTCACTAAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-587s21c1
Sequence:CCGGGAAATCACTCCTGAGTACTAACTCGAGTTAGTACTCAGGAGTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152603.2-2428s21c1
Sequence:CCGGACCACTTCCGTAGCCTATAACCTCGAGGTTATAGGCTACGGAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152603.2-284s21c1
Sequence:CCGGGACATCATTTGCAGGTCATACCTCGAGGTATGACCTGCAAATGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1756s1c1
Sequence:CCGGCCGGCCAGAAATCCTATGAATCTCGAGATTCATAGGATTTCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_152603.2-651s1c1
Sequence:CCGGGCCAGAGCTTTCAGTCATAATCTCGAGATTATGACTGAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-733s1c1
Sequence:CCGGGTGAGAAATCATTCCTTCAAACTCGAGTTTGAAGGAATGATTTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-480s1c1
Sequence:CCGGCCTCCTGAATATGATACTCATCTCGAGATGAGTATCATATTCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152603.2-1883s1c1
Sequence:CCGGCCGCCAGAAGACAAATCTTATCTCGAGATAAGATTTGTCTTCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks