EMAIL THIS PAGE TO A FRIEND

ZNF568

zinc finger protein 568

UniProtKB ID: Q3ZCX4, B4DS92, E7ER33, Q6N060, Q8NA64
Gene ID:
Domestic Rabbit(100344469) zinc finger protein 568
domestic guinea pig(100717639) zinc finger protein 568
cow(786874) zinc finger protein 568
chicken(421233) zinc finger protein 568
Horse(100061744) zinc finger protein 568
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198539 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175016 predicted 1051
2 SASI_Hs02_00372144 predicted 1800
3 SASI_Hs01_00175018 predicted 1216
4 SASI_Hs01_00175019 predicted 1031
5 SASI_Hs01_00175020 predicted 1427
6 SASI_Hs01_00175021 predicted 1708
7 SASI_Hs01_00175022 predicted 1123
8 SASI_Hs02_00372145 predicted 1810
9 SASI_Hs01_00175023 predicted 1108
10 SASI_Hs01_00175025 predicted 1378
11 SASI_Hs01_00175017 predicted 455
12 SASI_Hs01_00175024 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198539
ZNF568 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 568
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1479s1c1
Sequence:CCGGCCCTAACCGTACATGCGAAATCTCGAGATTTCGCATGTACGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1306s1c1
Sequence:CCGGGTCATCTGTTACGCTACATATCTCGAGATATGTAGCGTAACAGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-877s1c1
Sequence:CCGGCAGTCATAAATTTGACCTCATCTCGAGATGAGGTCAAATTTATGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1376s1c1
Sequence:CCGGGCTTTCTCTCAATGCTCAGTACTCGAGTACTGAGCATTGAGAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-728s1c1
Sequence:CCGGGATAAGGGTTTGGAACATAATCTCGAGATTATGTTCCAAACCCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198539
ZNF568 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 568
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1479s1c1
Sequence:CCGGCCCTAACCGTACATGCGAAATCTCGAGATTTCGCATGTACGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1306s1c1
Sequence:CCGGGTCATCTGTTACGCTACATATCTCGAGATATGTAGCGTAACAGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-877s1c1
Sequence:CCGGCAGTCATAAATTTGACCTCATCTCGAGATGAGGTCAAATTTATGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1376s1c1
Sequence:CCGGGCTTTCTCTCAATGCTCAGTACTCGAGTACTGAGCATTGAGAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-728s1c1
Sequence:CCGGGATAAGGGTTTGGAACATAATCTCGAGATTATGTTCCAAACCCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198539
ZNF568 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 568
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1479s1c1
Sequence:CCGGCCCTAACCGTACATGCGAAATCTCGAGATTTCGCATGTACGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1306s1c1
Sequence:CCGGGTCATCTGTTACGCTACATATCTCGAGATATGTAGCGTAACAGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-877s1c1
Sequence:CCGGCAGTCATAAATTTGACCTCATCTCGAGATGAGGTCAAATTTATGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-1376s1c1
Sequence:CCGGGCTTTCTCTCAATGCTCAGTACTCGAGTACTGAGCATTGAGAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198539.1-728s1c1
Sequence:CCGGGATAAGGGTTTGGAACATAATCTCGAGATTATGTTCCAAACCCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks