EMAIL THIS PAGE TO A FRIEND

ZNF569

zinc finger protein 569

Synonyms: ZAP1 ZNF
UniProtKB ID: Q5MCW4, A8K1S2, Q15925, Q96MQ2
Gene ID:
Horse(100062600) zinc finger protein 569
dog(100683371) zinc finger protein 569
cow(520008) zinc finger protein 569
sheep(101103915) zinc finger protein 569
domestic guinea pig(100719314) zinc finger protein 569
naked mole-rat(101724019) zinc finger protein 569
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017641 MISSION® esiRNA esiRNA targeting human ZNF569 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152484 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115218 predicted 972
2 SASI_Hs01_00115219 predicted 1398
3 SASI_Hs01_00115220 predicted 2667
4 SASI_Hs01_00115221 predicted 1899
5 SASI_Hs01_00115222 predicted 2653
6 SASI_Hs01_00115223 predicted 2316
7 SASI_Hs01_00115224 predicted 963
8 SASI_Hs01_00115225 predicted 2600
9 SASI_Hs01_00115226 predicted 2606
10 SASI_Hs01_00115227 predicted 2167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152484
ZNF569 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 569
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2434s1c1
Sequence:CCGGCGAGGACATACAGGTGAGAAACTCGAGTTTCTCACCTGTATGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-1031s1c1
Sequence:CCGGGCCTTATGAGAAAGGAGCATTCTCGAGAATGCTCCTTTCTCATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-953s1c1
Sequence:CCGGCCAGACACAATCTCTATGAGTCTCGAGACTCATAGAGATTGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2171s1c1
Sequence:CCGGCCCTTCATTTGAGAAGTCATACTCGAGTATGACTTCTCAAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2940s21c1
Sequence:CCGGGTATCAACGAAGAACTATAAACTCGAGTTTATAGTTCTTCGTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2818s21c1
Sequence:CCGGGCAGACATCTTATTGATAATACTCGAGTATTATCAATAAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152484.2-761s21c1
Sequence:CCGGTGATGGAGGAAGAAGTATTAACTCGAGTTAATACTTCTTCCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-3030s21c1
Sequence:CCGGGTTAGGTCTTTATCAAGTTATCTCGAGATAACTTGATAAAGACCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152484
ZNF569 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 569
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2434s1c1
Sequence:CCGGCGAGGACATACAGGTGAGAAACTCGAGTTTCTCACCTGTATGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-1031s1c1
Sequence:CCGGGCCTTATGAGAAAGGAGCATTCTCGAGAATGCTCCTTTCTCATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-953s1c1
Sequence:CCGGCCAGACACAATCTCTATGAGTCTCGAGACTCATAGAGATTGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2171s1c1
Sequence:CCGGCCCTTCATTTGAGAAGTCATACTCGAGTATGACTTCTCAAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2940s21c1
Sequence:CCGGGTATCAACGAAGAACTATAAACTCGAGTTTATAGTTCTTCGTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2818s21c1
Sequence:CCGGGCAGACATCTTATTGATAATACTCGAGTATTATCAATAAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152484.2-761s21c1
Sequence:CCGGTGATGGAGGAAGAAGTATTAACTCGAGTTAATACTTCTTCCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-3030s21c1
Sequence:CCGGGTTAGGTCTTTATCAAGTTATCTCGAGATAACTTGATAAAGACCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152484
ZNF569 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 569
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2434s1c1
Sequence:CCGGCGAGGACATACAGGTGAGAAACTCGAGTTTCTCACCTGTATGTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-1031s1c1
Sequence:CCGGGCCTTATGAGAAAGGAGCATTCTCGAGAATGCTCCTTTCTCATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-953s1c1
Sequence:CCGGCCAGACACAATCTCTATGAGTCTCGAGACTCATAGAGATTGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152484.2-2171s1c1
Sequence:CCGGCCCTTCATTTGAGAAGTCATACTCGAGTATGACTTCTCAAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2940s21c1
Sequence:CCGGGTATCAACGAAGAACTATAAACTCGAGTTTATAGTTCTTCGTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-2818s21c1
Sequence:CCGGGCAGACATCTTATTGATAATACTCGAGTATTATCAATAAGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152484.2-761s21c1
Sequence:CCGGTGATGGAGGAAGAAGTATTAACTCGAGTTAATACTTCTTCCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152484.2-3030s21c1
Sequence:CCGGGTTAGGTCTTTATCAAGTTATCTCGAGATAACTTGATAAAGACCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks