EMAIL THIS PAGE TO A FRIEND

ZNF570

zinc finger protein 570

UniProtKB ID: Q96NI8, A1L472
Gene ID:
dog(100682755) zinc finger protein 570
naked mole-rat(101715511) zinc finger protein 570
Domestic Rabbit(100351821) zinc finger protein 570
domestic guinea pig(100729442) zinc finger protein 570
cow(100138971) zinc finger protein 570
sheep(101103173) zinc finger protein 570
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144694 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018611 MISSION® esiRNA esiRNA targeting human ZNF570 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241528 predicted 1389
2 SASI_Hs01_00241530 predicted 868
3 SASI_Hs01_00241531 predicted 859
4 SASI_Hs01_00241532 predicted 670
5 SASI_Hs01_00241533 predicted 883
6 SASI_Hs01_00241535 predicted 1785
7 SASI_Hs02_00364615 predicted 705
8 SASI_Hs01_00241529 predicted 1544
9 SASI_Hs02_00364616 predicted 895
10 SASI_Hs02_00364617 predicted 835
11 SASI_Hs01_00241534 predicted 1385
12 SASI_Hs01_00241536 predicted 799
13 SASI_Hs01_00241537 predicted 1627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144694
VALIDATED
ZNF570 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 570
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1503s1c1
Sequence:CCGGCGGGAGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-971s1c1
Sequence:CCGGGAAGAGATAATCACTCATGAACTCGAGTTCATGAGTGATTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1347s1c1
Sequence:CCGGCCTATGAATGTAAGGAATGTACTCGAGTACATTCCTTACATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-658s1c1
Sequence:CCGGGCTAGAGAACTACAGGATCTTCTCGAGAAGATCCTGTAGTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1817s1c1
Sequence:CCGGGCTCAGCATCAAAGAGTTCATCTCGAGATGAACTCTTTGATGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1634s1c1
Sequence:CCGGCTTCGTGCATACCTTACTGTACTCGAGTACAGTAAGGTATGCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1382s1c1
Sequence:CCGGCAGAATGCACACCTAGTTCAACTCGAGTTGAACTAGGTGTGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1079s1c1
Sequence:CCGGCCCAAAGAGGAGAAAGTACATCTCGAGATGTACTTTCTCCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-911s1c1
Sequence:CCGGGAGTGGAAATGTGAGGGCTATCTCGAGATAGCCCTCACATTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1153s1c1
Sequence:CCGGCAAGAGTGTCTGTGCAGAGAACTCGAGTTCTCTGCACAGACACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144694
VALIDATED
ZNF570 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 570
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1503s1c1
Sequence:CCGGCGGGAGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-971s1c1
Sequence:CCGGGAAGAGATAATCACTCATGAACTCGAGTTCATGAGTGATTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1347s1c1
Sequence:CCGGCCTATGAATGTAAGGAATGTACTCGAGTACATTCCTTACATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-658s1c1
Sequence:CCGGGCTAGAGAACTACAGGATCTTCTCGAGAAGATCCTGTAGTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1817s1c1
Sequence:CCGGGCTCAGCATCAAAGAGTTCATCTCGAGATGAACTCTTTGATGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1634s1c1
Sequence:CCGGCTTCGTGCATACCTTACTGTACTCGAGTACAGTAAGGTATGCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1382s1c1
Sequence:CCGGCAGAATGCACACCTAGTTCAACTCGAGTTGAACTAGGTGTGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1079s1c1
Sequence:CCGGCCCAAAGAGGAGAAAGTACATCTCGAGATGTACTTTCTCCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-911s1c1
Sequence:CCGGGAGTGGAAATGTGAGGGCTATCTCGAGATAGCCCTCACATTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1153s1c1
Sequence:CCGGCAAGAGTGTCTGTGCAGAGAACTCGAGTTCTCTGCACAGACACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144694
VALIDATED
ZNF570 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 570
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1503s1c1
Sequence:CCGGCGGGAGAGAAACCCTATGAATCTCGAGATTCATAGGGTTTCTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-971s1c1
Sequence:CCGGGAAGAGATAATCACTCATGAACTCGAGTTCATGAGTGATTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1347s1c1
Sequence:CCGGCCTATGAATGTAAGGAATGTACTCGAGTACATTCCTTACATTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-658s1c1
Sequence:CCGGGCTAGAGAACTACAGGATCTTCTCGAGAAGATCCTGTAGTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1817s1c1
Sequence:CCGGGCTCAGCATCAAAGAGTTCATCTCGAGATGAACTCTTTGATGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1634s1c1
Sequence:CCGGCTTCGTGCATACCTTACTGTACTCGAGTACAGTAAGGTATGCACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1382s1c1
Sequence:CCGGCAGAATGCACACCTAGTTCAACTCGAGTTGAACTAGGTGTGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-1079s1c1
Sequence:CCGGCCCAAAGAGGAGAAAGTACATCTCGAGATGTACTTTCTCCTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144694.1-911s1c1
Sequence:CCGGGAGTGGAAATGTGAGGGCTATCTCGAGATAGCCCTCACATTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_144694.1-1153s1c1
Sequence:CCGGCAAGAGTGTCTGTGCAGAGAACTCGAGTTCTCTGCACAGACACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks