EMAIL THIS PAGE TO A FRIEND

ZNF571

zinc finger protein 571

UniProtKB ID: Q7Z3V5, Q2HIY0, Q3ZCU3, Q9NZX7
Gene ID:
Horse(100062006) zinc finger protein 571
dog(100683671) zinc finger protein 571
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111071 MISSION® esiRNA esiRNA human ZNF571 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016536 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037779 predicted 324
2 SASI_Hs01_00037780 predicted 1555
3 SASI_Hs01_00037781 predicted 636
4 SASI_Hs01_00037782 predicted 602
5 SASI_Hs01_00037784 predicted 553
6 SASI_Hs01_00037786 predicted 1848
7 SASI_Hs01_00037787 predicted 1542
8 SASI_Hs02_00349641 predicted 530
9 SASI_Hs01_00037788 predicted 2005
10 SASI_Hs02_00349642 predicted 2025
11 SASI_Hs01_00037783 predicted 1969
12 SASI_Hs01_00037785 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016536
VALIDATED
ZNF571 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 571
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016536.2-662s1c1
Sequence:CCGGGCTATATTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1573s1c1
Sequence:CCGGCGTGCTACACAACTTACATATCTCGAGATATGTAAGTTGTGTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-346s1c1
Sequence:CCGGCGTATCAACCATCACCTTCAACTCGAGTTGAAGGTGATGGTTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1925s1c1
Sequence:CCGGCTCAACATACAAGGCTTCATACTCGAGTATGAAGCCTTGTATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1492s1c1
Sequence:CCGGCGTGTTGCATATCTTACTCAACTCGAGTTGAGTAAGATATGCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-546s21c1
Sequence:CCGGAGCTACCTGTCATGCCTTATTCTCGAGAATAAGGCATGACAGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-299s21c1
Sequence:CCGGATCACTCCAGTGGGAGAATATCTCGAGATATTCTCCCACTGGAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-370s21c1
Sequence:CCGGTGGAGTGCAAAGGCAACTTAGCTCGAGCTAAGTTGCCTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016536
VALIDATED
ZNF571 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 571
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016536.2-662s1c1
Sequence:CCGGGCTATATTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1573s1c1
Sequence:CCGGCGTGCTACACAACTTACATATCTCGAGATATGTAAGTTGTGTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-346s1c1
Sequence:CCGGCGTATCAACCATCACCTTCAACTCGAGTTGAAGGTGATGGTTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1925s1c1
Sequence:CCGGCTCAACATACAAGGCTTCATACTCGAGTATGAAGCCTTGTATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1492s1c1
Sequence:CCGGCGTGTTGCATATCTTACTCAACTCGAGTTGAGTAAGATATGCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-546s21c1
Sequence:CCGGAGCTACCTGTCATGCCTTATTCTCGAGAATAAGGCATGACAGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-299s21c1
Sequence:CCGGATCACTCCAGTGGGAGAATATCTCGAGATATTCTCCCACTGGAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-370s21c1
Sequence:CCGGTGGAGTGCAAAGGCAACTTAGCTCGAGCTAAGTTGCCTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016536
VALIDATED
ZNF571 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 571
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016536.2-662s1c1
Sequence:CCGGGCTATATTCAACATCAGAGAACTCGAGTTCTCTGATGTTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1573s1c1
Sequence:CCGGCGTGCTACACAACTTACATATCTCGAGATATGTAAGTTGTGTAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-346s1c1
Sequence:CCGGCGTATCAACCATCACCTTCAACTCGAGTTGAAGGTGATGGTTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1925s1c1
Sequence:CCGGCTCAACATACAAGGCTTCATACTCGAGTATGAAGCCTTGTATGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016536.2-1492s1c1
Sequence:CCGGCGTGTTGCATATCTTACTCAACTCGAGTTGAGTAAGATATGCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-546s21c1
Sequence:CCGGAGCTACCTGTCATGCCTTATTCTCGAGAATAAGGCATGACAGGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-299s21c1
Sequence:CCGGATCACTCCAGTGGGAGAATATCTCGAGATATTCTCCCACTGGAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016536.3-370s21c1
Sequence:CCGGTGGAGTGCAAAGGCAACTTAGCTCGAGCTAAGTTGCCTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks