EMAIL THIS PAGE TO A FRIEND

ZNF572

zinc finger protein 572

UniProtKB ID: Q7Z3I7, A1L4F1, Q8N1Q0
Gene ID:
Horse(100067596) zinc finger protein 572
domestic cat(101090742) zinc finger protein 572
dog(482038) zinc finger protein 572
cow(768004) zinc finger protein 572
sheep(101104915) zinc finger protein 572
domestic guinea pig(100732928) zinc finger protein 572
Domestic Rabbit(100352909) zinc finger protein 572
naked mole-rat(101709664) zinc finger protein 572
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026961 MISSION® esiRNA esiRNA human ZNF572 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152412 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366117 predicted 1795
2 SASI_Hs01_00148062 predicted 1677
3 SASI_Hs01_00148065 predicted 516
4 SASI_Hs01_00148066 predicted 1256
5 SASI_Hs01_00148067 predicted 369
6 SASI_Hs01_00148068 predicted 1227
7 SASI_Hs01_00148069 predicted 1069
8 SASI_Hs01_00148070 predicted 1762
9 SASI_Hs02_00366118 predicted 1243
10 SASI_Hs02_00366119 predicted 1755
11 SASI_Hs01_00148063 predicted 1043
12 SASI_Hs01_00148064 predicted 1810
13 SASI_Hs01_00148071 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152412
ZNF572 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 572
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-1809s21c1
Sequence:CCGGTGTGATTGTTGTGCTATAAAGCTCGAGCTTTATAGCACAACAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-2239s21c1
Sequence:CCGGGTCGTACCATCTAGAACTATACTCGAGTATAGTTCTAGATGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-327s21c1
Sequence:CCGGCATAGACCACAACATTATAAGCTCGAGCTTATAATGTTGTGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-749s21c1
Sequence:CCGGCAATACCTCCCATCTTATTATCTCGAGATAATAAGATGGGAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-1215s1c1
Sequence:CCGGGTTCTGAATATGAGGAAAGTTCTCGAGAACTTTCCTCATATTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-905s1c1
Sequence:CCGGCACAGCTATGTCCTAATAGAACTCGAGTTCTATTAGGACATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152412.1-2631s1c1
Sequence:CCGGGCCAGAATAGAAGGCAGGATTCTCGAGAATCCTGCCTTCTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-519s1c1
Sequence:CCGGCCTTTGTAGACAGACCCTATACTCGAGTATAGGGTCTGTCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-520s1c1
Sequence:CCGGCTTTGTAGACAGACCCTATAACTCGAGTTATAGGGTCTGTCTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152412
ZNF572 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 572
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-1809s21c1
Sequence:CCGGTGTGATTGTTGTGCTATAAAGCTCGAGCTTTATAGCACAACAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-2239s21c1
Sequence:CCGGGTCGTACCATCTAGAACTATACTCGAGTATAGTTCTAGATGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-327s21c1
Sequence:CCGGCATAGACCACAACATTATAAGCTCGAGCTTATAATGTTGTGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-749s21c1
Sequence:CCGGCAATACCTCCCATCTTATTATCTCGAGATAATAAGATGGGAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-1215s1c1
Sequence:CCGGGTTCTGAATATGAGGAAAGTTCTCGAGAACTTTCCTCATATTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-905s1c1
Sequence:CCGGCACAGCTATGTCCTAATAGAACTCGAGTTCTATTAGGACATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152412.1-2631s1c1
Sequence:CCGGGCCAGAATAGAAGGCAGGATTCTCGAGAATCCTGCCTTCTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-519s1c1
Sequence:CCGGCCTTTGTAGACAGACCCTATACTCGAGTATAGGGTCTGTCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-520s1c1
Sequence:CCGGCTTTGTAGACAGACCCTATAACTCGAGTTATAGGGTCTGTCTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152412
ZNF572 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 572
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-1809s21c1
Sequence:CCGGTGTGATTGTTGTGCTATAAAGCTCGAGCTTTATAGCACAACAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152412.2-2239s21c1
Sequence:CCGGGTCGTACCATCTAGAACTATACTCGAGTATAGTTCTAGATGGTACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-327s21c1
Sequence:CCGGCATAGACCACAACATTATAAGCTCGAGCTTATAATGTTGTGGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152412.2-749s21c1
Sequence:CCGGCAATACCTCCCATCTTATTATCTCGAGATAATAAGATGGGAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-1215s1c1
Sequence:CCGGGTTCTGAATATGAGGAAAGTTCTCGAGAACTTTCCTCATATTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-905s1c1
Sequence:CCGGCACAGCTATGTCCTAATAGAACTCGAGTTCTATTAGGACATAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152412.1-2631s1c1
Sequence:CCGGGCCAGAATAGAAGGCAGGATTCTCGAGAATCCTGCCTTCTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-519s1c1
Sequence:CCGGCCTTTGTAGACAGACCCTATACTCGAGTATAGGGTCTGTCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152412.1-520s1c1
Sequence:CCGGCTTTGTAGACAGACCCTATAACTCGAGTTATAGGGTCTGTCTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks