EMAIL THIS PAGE TO A FRIEND

ZNF573

zinc finger protein 573

Species: Human ZNF573(126231), naked mole-rat Znf573(101726696)
Gene ID:
naked mole-rat(101726696) zinc finger protein 573
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152360 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152360 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149700 predicted 1324
2 SASI_Hs01_00149701 predicted 1562
3 SASI_Hs01_00149702 predicted 1806
4 SASI_Hs01_00149704 predicted 1978
5 SASI_Hs01_00149705 predicted 1413
6 SASI_Hs01_00149706 predicted 1563
7 SASI_Hs01_00149707 predicted 1810
8 SASI_Hs01_00149708 predicted 1458
9 SASI_Hs02_00366003 predicted 801
10 SASI_Hs01_00149709 predicted 1187
11 SASI_Hs01_00149703 predicted 1826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152360
VALIDATED
ZNF573 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 573
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-635s1c1
Sequence:CCGGCCCACTTATGAAACAGATATACTCGAGTATATCTGTTTCATAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-1154s1c1
Sequence:CCGGCGCTCAAATCTTGTTGAACATCTCGAGATGTTCAACAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-621s1c1
Sequence:CCGGGCTACATAGAAGTACCCACTTCTCGAGAAGTGGGTACTTCTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-2239s1c1
Sequence:CCGGCAGATATGGTTCAGCCCTTAACTCGAGTTAAGGGCTGAACCATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152360.2-1058s1c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-662s21c1
Sequence:CCGGACACAACTTCAGAGCATATATCTCGAGATATATGCTCTGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-1058s21c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152360.2-2316s21c1
Sequence:CCGGGCGCCATTCATCATCAGACAGCTCGAGCTGTCTGATGATGAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-1568s21c1
Sequence:CCGGAGCTTGTATGGCTACCTTAAACTCGAGTTTAAGGTAGCCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-728s21c1
Sequence:CCGGAGTAGTGGTTATCAACTTATTCTCGAGAATAAGTTGATAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152360
VALIDATED
ZNF573 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 573
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-635s1c1
Sequence:CCGGCCCACTTATGAAACAGATATACTCGAGTATATCTGTTTCATAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-1154s1c1
Sequence:CCGGCGCTCAAATCTTGTTGAACATCTCGAGATGTTCAACAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-621s1c1
Sequence:CCGGGCTACATAGAAGTACCCACTTCTCGAGAAGTGGGTACTTCTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-2239s1c1
Sequence:CCGGCAGATATGGTTCAGCCCTTAACTCGAGTTAAGGGCTGAACCATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152360.2-1058s1c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-662s21c1
Sequence:CCGGACACAACTTCAGAGCATATATCTCGAGATATATGCTCTGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-1058s21c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152360.2-2316s21c1
Sequence:CCGGGCGCCATTCATCATCAGACAGCTCGAGCTGTCTGATGATGAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-1568s21c1
Sequence:CCGGAGCTTGTATGGCTACCTTAAACTCGAGTTTAAGGTAGCCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-728s21c1
Sequence:CCGGAGTAGTGGTTATCAACTTATTCTCGAGAATAAGTTGATAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152360
VALIDATED
ZNF573 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 573
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-635s1c1
Sequence:CCGGCCCACTTATGAAACAGATATACTCGAGTATATCTGTTTCATAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-1154s1c1
Sequence:CCGGCGCTCAAATCTTGTTGAACATCTCGAGATGTTCAACAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-621s1c1
Sequence:CCGGGCTACATAGAAGTACCCACTTCTCGAGAAGTGGGTACTTCTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152360.2-2239s1c1
Sequence:CCGGCAGATATGGTTCAGCCCTTAACTCGAGTTAAGGGCTGAACCATATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152360.2-1058s1c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-662s21c1
Sequence:CCGGACACAACTTCAGAGCATATATCTCGAGATATATGCTCTGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-1058s21c1
Sequence:CCGGGCCTTTAGTCAAGGTGGACATCTCGAGATGTCCACCTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152360.2-2316s21c1
Sequence:CCGGGCGCCATTCATCATCAGACAGCTCGAGCTGTCTGATGATGAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152360.2-1568s21c1
Sequence:CCGGAGCTTGTATGGCTACCTTAAACTCGAGTTTAAGGTAGCCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152360.2-728s21c1
Sequence:CCGGAGTAGTGGTTATCAACTTATTCTCGAGAATAAGTTGATAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks