EMAIL THIS PAGE TO A FRIEND

ZNF574

zinc finger protein 574

Synonyms: FP972
UniProtKB ID: Q6ZN55, Q6IPE0, Q6ZN10, Q7L5Z5, Q8NCE3, Q9H6N0
Gene ID:
Zebrafish(798589) zinc finger protein 574
Horse(100069727) zinc finger protein 574
domestic cat(101084668) zinc finger protein 574
dog(484479) zinc finger protein 574
naked mole-rat(101720448) zinc finger protein 574
domestic guinea pig(100723985) zinc finger protein 574
cow(767618) zinc finger protein 574
sheep(101103259) zinc finger protein 574
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022752 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078611 MISSION® esiRNA esiRNA human ZNF574 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022752 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062269 predicted 2398
2 SASI_Hs01_00062270 predicted 799
3 SASI_Hs01_00062271 predicted 1359
4 SASI_Hs01_00062272 predicted 1652
5 SASI_Hs01_00062273 predicted 1341
6 SASI_Hs01_00062274 predicted 2164
7 SASI_Hs01_00062275 predicted 1676
8 SASI_Hs01_00062276 predicted 987
9 SASI_Hs02_00356009 predicted 1694
10 SASI_Hs01_00062277 predicted 1930
11 SASI_Hs01_00062278 predicted 1863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022752
ZNF574 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 574
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-555s21c1
Sequence:CCGGTGGATTGCAAGGCTCTCTTTGCTCGAGCAAAGAGAGCCTTGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022752.5-2966s21c1
Sequence:CCGGACCACCTTGTAAGTTCTAAATCTCGAGATTTAGAACTTACAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1648s21c1
Sequence:CCGGGCGCCATAAATGCAGCATTTGCTCGAGCAAATGCTGCATTTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1574s21c1
Sequence:CCGGCTCCTGTGCAGCCGTGAATTTCTCGAGAAATTCACGGCTGCACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-247s21c1
Sequence:CCGGATCACTGGAAGAGGTGCTTATCTCGAGATAAGCACCTCTTCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1851s1c1
Sequence:CCGGGCTACCATCACACAGGTGAATCTCGAGATTCACCTGTGTGATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-938s1c1
Sequence:CCGGCGGAGGAACAACAGTGGAGAACTCGAGTTCTCCACTGTTGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-135s1c1
Sequence:CCGGGATCACTGGAAGAGGTGCTTACTCGAGTAAGCACCTCTTCCAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-2384s1c1
Sequence:CCGGCGTCAGAGTACCCACCTGAAACTCGAGTTTCAGGTGGGTACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1548s1c1
Sequence:CCGGGCAGCATTTGTGGCAAGATGTCTCGAGACATCTTGCCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022752
ZNF574 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 574
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-555s21c1
Sequence:CCGGTGGATTGCAAGGCTCTCTTTGCTCGAGCAAAGAGAGCCTTGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022752.5-2966s21c1
Sequence:CCGGACCACCTTGTAAGTTCTAAATCTCGAGATTTAGAACTTACAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1648s21c1
Sequence:CCGGGCGCCATAAATGCAGCATTTGCTCGAGCAAATGCTGCATTTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1574s21c1
Sequence:CCGGCTCCTGTGCAGCCGTGAATTTCTCGAGAAATTCACGGCTGCACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-247s21c1
Sequence:CCGGATCACTGGAAGAGGTGCTTATCTCGAGATAAGCACCTCTTCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1851s1c1
Sequence:CCGGGCTACCATCACACAGGTGAATCTCGAGATTCACCTGTGTGATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-938s1c1
Sequence:CCGGCGGAGGAACAACAGTGGAGAACTCGAGTTCTCCACTGTTGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-135s1c1
Sequence:CCGGGATCACTGGAAGAGGTGCTTACTCGAGTAAGCACCTCTTCCAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-2384s1c1
Sequence:CCGGCGTCAGAGTACCCACCTGAAACTCGAGTTTCAGGTGGGTACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1548s1c1
Sequence:CCGGGCAGCATTTGTGGCAAGATGTCTCGAGACATCTTGCCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022752
ZNF574 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 574
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-555s21c1
Sequence:CCGGTGGATTGCAAGGCTCTCTTTGCTCGAGCAAAGAGAGCCTTGCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022752.5-2966s21c1
Sequence:CCGGACCACCTTGTAAGTTCTAAATCTCGAGATTTAGAACTTACAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1648s21c1
Sequence:CCGGGCGCCATAAATGCAGCATTTGCTCGAGCAAATGCTGCATTTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-1574s21c1
Sequence:CCGGCTCCTGTGCAGCCGTGAATTTCTCGAGAAATTCACGGCTGCACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022752.5-247s21c1
Sequence:CCGGATCACTGGAAGAGGTGCTTATCTCGAGATAAGCACCTCTTCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1851s1c1
Sequence:CCGGGCTACCATCACACAGGTGAATCTCGAGATTCACCTGTGTGATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-938s1c1
Sequence:CCGGCGGAGGAACAACAGTGGAGAACTCGAGTTCTCCACTGTTGTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-135s1c1
Sequence:CCGGGATCACTGGAAGAGGTGCTTACTCGAGTAAGCACCTCTTCCAGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-2384s1c1
Sequence:CCGGCGTCAGAGTACCCACCTGAAACTCGAGTTTCAGGTGGGTACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022752.2-1548s1c1
Sequence:CCGGGCAGCATTTGTGGCAAGATGTCTCGAGACATCTTGCCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks