EMAIL THIS PAGE TO A FRIEND

ZNF575

zinc finger protein 575

UniProtKB ID: Q86XF7, B4DX54
Gene ID:
cow(504571) zinc finger protein 575
sheep(101106029) zinc finger protein 575
domestic guinea pig(100727191) zinc finger protein 575
naked mole-rat(101700190) zinc finger protein 575
domestic cat(101092314) zinc finger protein 575
dog(484469) zinc finger protein 575
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174945 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174945 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221392 predicted 1026
2 SASI_Hs01_00221393 predicted 1036
3 SASI_Hs01_00221394 predicted 932
4 SASI_Hs01_00221395 predicted 848
5 SASI_Hs01_00221396 predicted 928
6 SASI_Hs01_00221397 predicted 980
7 SASI_Hs01_00221398 predicted 1029
8 SASI_Hs01_00221399 predicted 747
9 SASI_Hs01_00221400 predicted 1119
10 SASI_Hs02_00368887 predicted 1035
11 SASI_Hs01_00221401 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174945
VALIDATED
ZNF575 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 575
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1340s1c1
Sequence:CCGGCCCACACACTTACATGGCAAACTCGAGTTTGCCATGTAAGTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-823s1c1
Sequence:CCGGGTCCTTCTGCTACCCTTCCAACTCGAGTTGGAAGGGTAGCAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1031s1c1
Sequence:CCGGCAGAGACGCTTACTGCTCCTTCTCGAGAAGGAGCAGTAAGCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-400s1c1
Sequence:CCGGCGATCCTAGTCCCACTGGCAACTCGAGTTGCCAGTGGGACTAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1037s1c1
Sequence:CCGGCGCTTACTGCTCCTTCATCAACTCGAGTTGATGAAGGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174945.2-1570s21c1
Sequence:CCGGGCAAACAGGCTCTCTTGTTAACTCGAGTTAACAAGAGAGCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174945.2-732s21c1
Sequence:CCGGTGACAAGGCCTTCTCGTACCCCTCGAGGGGTACGAGAAGGCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174945
VALIDATED
ZNF575 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 575
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1340s1c1
Sequence:CCGGCCCACACACTTACATGGCAAACTCGAGTTTGCCATGTAAGTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-823s1c1
Sequence:CCGGGTCCTTCTGCTACCCTTCCAACTCGAGTTGGAAGGGTAGCAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1031s1c1
Sequence:CCGGCAGAGACGCTTACTGCTCCTTCTCGAGAAGGAGCAGTAAGCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-400s1c1
Sequence:CCGGCGATCCTAGTCCCACTGGCAACTCGAGTTGCCAGTGGGACTAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1037s1c1
Sequence:CCGGCGCTTACTGCTCCTTCATCAACTCGAGTTGATGAAGGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174945.2-1570s21c1
Sequence:CCGGGCAAACAGGCTCTCTTGTTAACTCGAGTTAACAAGAGAGCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174945.2-732s21c1
Sequence:CCGGTGACAAGGCCTTCTCGTACCCCTCGAGGGGTACGAGAAGGCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174945
VALIDATED
ZNF575 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 575
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1340s1c1
Sequence:CCGGCCCACACACTTACATGGCAAACTCGAGTTTGCCATGTAAGTGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-823s1c1
Sequence:CCGGGTCCTTCTGCTACCCTTCCAACTCGAGTTGGAAGGGTAGCAGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1031s1c1
Sequence:CCGGCAGAGACGCTTACTGCTCCTTCTCGAGAAGGAGCAGTAAGCGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-400s1c1
Sequence:CCGGCGATCCTAGTCCCACTGGCAACTCGAGTTGCCAGTGGGACTAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174945.1-1037s1c1
Sequence:CCGGCGCTTACTGCTCCTTCATCAACTCGAGTTGATGAAGGAGCAGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174945.2-1570s21c1
Sequence:CCGGGCAAACAGGCTCTCTTGTTAACTCGAGTTAACAAGAGAGCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174945.2-732s21c1
Sequence:CCGGTGACAAGGCCTTCTCGTACCCCTCGAGGGGTACGAGAAGGCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks