EMAIL THIS PAGE TO A FRIEND

ZNF576

zinc finger protein 576

UniProtKB ID: Q9H609, Q9BU03
Gene ID:
dog(484467) zinc finger protein 576
domestic cat(101091671) zinc finger protein 576
naked mole-rat(101703042) zinc finger protein 576
domestic guinea pig(100728028) zinc finger protein 576
cow(616814) zinc finger protein 576
sheep(101108943) zinc finger protein 576
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024327 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076731 MISSION® esiRNA esiRNA human ZNF576 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024327 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356676 predicted 383
2 SASI_Hs01_00219208 predicted 319
3 SASI_Hs01_00219209 predicted 321
4 SASI_Hs01_00219210 predicted 642
5 SASI_Hs01_00219211 predicted 565
6 SASI_Hs01_00219212 predicted 646
7 SASI_Hs01_00219213 predicted 349
8 SASI_Hs01_00219214 predicted 713
9 SASI_Hs01_00219215 predicted 678
10 SASI_Hs01_00219216 predicted 340
11 SASI_Hs01_00219217 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024327
VALIDATED
ZNF576 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 576
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-836s21c1
Sequence:CCGGGAAGGCAGAGGGCTCTTAATACTCGAGTATTAAGAGCCCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-565s21c1
Sequence:CCGGAGACCTTTGGGCAGGCTGTTTCTCGAGAAACAGCCTGCCCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-452s21c1
Sequence:CCGGCTCCTCCAAAGCCCTAATCACCTCGAGGTGATTAGGGCTTTGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-242s21c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-684s21c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024327.2-1071s21c1
Sequence:CCGGATGGGCTATGGGAGCAAATTGCTCGAGCAATTTGCTCCCATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024327.1-1320s1c1
Sequence:CCGGCCCGATAATTTATGTCTCGTTCTCGAGAACGAGACATAAATTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-335s1c1
Sequence:CCGGCTTCGCAGATTCCAAGTTCCACTCGAGTGGAACTTGGAATCTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-508s1c1
Sequence:CCGGCCCTGCCGGTTGCAACCACTACTCGAGTAGTGGTTGCAACCGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-242s1c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-684s1c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024327
VALIDATED
ZNF576 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 576
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-836s21c1
Sequence:CCGGGAAGGCAGAGGGCTCTTAATACTCGAGTATTAAGAGCCCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-565s21c1
Sequence:CCGGAGACCTTTGGGCAGGCTGTTTCTCGAGAAACAGCCTGCCCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-452s21c1
Sequence:CCGGCTCCTCCAAAGCCCTAATCACCTCGAGGTGATTAGGGCTTTGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-242s21c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-684s21c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024327.2-1071s21c1
Sequence:CCGGATGGGCTATGGGAGCAAATTGCTCGAGCAATTTGCTCCCATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024327.1-1320s1c1
Sequence:CCGGCCCGATAATTTATGTCTCGTTCTCGAGAACGAGACATAAATTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-335s1c1
Sequence:CCGGCTTCGCAGATTCCAAGTTCCACTCGAGTGGAACTTGGAATCTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-508s1c1
Sequence:CCGGCCCTGCCGGTTGCAACCACTACTCGAGTAGTGGTTGCAACCGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-242s1c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-684s1c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024327
VALIDATED
ZNF576 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 576
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-836s21c1
Sequence:CCGGGAAGGCAGAGGGCTCTTAATACTCGAGTATTAAGAGCCCTCTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-565s21c1
Sequence:CCGGAGACCTTTGGGCAGGCTGTTTCTCGAGAAACAGCCTGCCCAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-452s21c1
Sequence:CCGGCTCCTCCAAAGCCCTAATCACCTCGAGGTGATTAGGGCTTTGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024327.2-242s21c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024327.2-684s21c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024327.2-1071s21c1
Sequence:CCGGATGGGCTATGGGAGCAAATTGCTCGAGCAATTTGCTCCCATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024327.1-1320s1c1
Sequence:CCGGCCCGATAATTTATGTCTCGTTCTCGAGAACGAGACATAAATTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-335s1c1
Sequence:CCGGCTTCGCAGATTCCAAGTTCCACTCGAGTGGAACTTGGAATCTGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024327.1-508s1c1
Sequence:CCGGCCCTGCCGGTTGCAACCACTACTCGAGTAGTGGTTGCAACCGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-242s1c1
Sequence:CCGGGCAGCAGGATTCACCCAAGGACTCGAGTCCTTGGGTGAATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024327.1-684s1c1
Sequence:CCGGCATCAACACTACATTCGGCATCTCGAGATGCCGAATGTAGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks