EMAIL THIS PAGE TO A FRIEND

ZNF577

zinc finger protein 577

UniProtKB ID: Q9BSK1, A8K0B4, A8K6Z7, C9JFB9
Gene ID:
cow(787554) zinc finger protein 577
sheep(101103089) zinc finger protein 577
dog(491432) zinc finger protein 577
Horse(100065404) zinc finger protein 577
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032679 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171240 predicted 1533
2 SASI_Hs01_00171242 predicted 1160
3 SASI_Hs01_00171243 predicted 1543
4 SASI_Hs01_00171244 predicted 1513
5 SASI_Hs01_00171245 predicted 703
6 SASI_Hs01_00171246 predicted 1732
7 SASI_Hs01_00171247 predicted 1255
8 SASI_Hs01_00171248 predicted 625
9 SASI_Hs01_00171249 predicted 741
10 SASI_Hs02_00360216 predicted 1447
11 SASI_Hs01_00171241 predicted 1487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032679
ZNF577 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 577
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1705s1c1
Sequence:CCGGCCTTTGTAGTTAATCAGGAATCTCGAGATTCCTGATTAACTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-560s1c1
Sequence:CCGGCAAGCCAGATTCGCTCTTCAACTCGAGTTGAAGAGCGAATCTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1731s1c1
Sequence:CCGGCAGAGAATAAGCCTCACAAATCTCGAGATTTGTGAGGCTTATTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1450s1c1
Sequence:CCGGCCCACATGTCAGTCCTCATTACTCGAGTAATGAGGACTGACATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032679.2-2241s21c1
Sequence:CCGGTGATGGCAACTCACCAAATTACTCGAGTAATTTGGTGAGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032679.2-1520s21c1
Sequence:CCGGATAAGAGAGACAGCCATAAATCTCGAGATTTATGGCTGTCTCTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032679
ZNF577 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 577
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1705s1c1
Sequence:CCGGCCTTTGTAGTTAATCAGGAATCTCGAGATTCCTGATTAACTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-560s1c1
Sequence:CCGGCAAGCCAGATTCGCTCTTCAACTCGAGTTGAAGAGCGAATCTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1731s1c1
Sequence:CCGGCAGAGAATAAGCCTCACAAATCTCGAGATTTGTGAGGCTTATTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1450s1c1
Sequence:CCGGCCCACATGTCAGTCCTCATTACTCGAGTAATGAGGACTGACATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032679.2-2241s21c1
Sequence:CCGGTGATGGCAACTCACCAAATTACTCGAGTAATTTGGTGAGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032679.2-1520s21c1
Sequence:CCGGATAAGAGAGACAGCCATAAATCTCGAGATTTATGGCTGTCTCTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032679
ZNF577 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 577
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1705s1c1
Sequence:CCGGCCTTTGTAGTTAATCAGGAATCTCGAGATTCCTGATTAACTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-560s1c1
Sequence:CCGGCAAGCCAGATTCGCTCTTCAACTCGAGTTGAAGAGCGAATCTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1731s1c1
Sequence:CCGGCAGAGAATAAGCCTCACAAATCTCGAGATTTGTGAGGCTTATTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032679.1-1450s1c1
Sequence:CCGGCCCACATGTCAGTCCTCATTACTCGAGTAATGAGGACTGACATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032679.2-2241s21c1
Sequence:CCGGTGATGGCAACTCACCAAATTACTCGAGTAATTTGGTGAGTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032679.2-1520s21c1
Sequence:CCGGATAAGAGAGACAGCCATAAATCTCGAGATTTATGGCTGTCTCTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks