EMAIL THIS PAGE TO A FRIEND

ZNF578

zinc finger protein 578

Species: Human ZNF578(147660)
UniProtKB ID: Q96N58, B4DR51, I3L1Y6
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321145 predicted 606
2 SASI_Hs02_00321146 predicted 1966
3 SASI_Hs02_00321147 predicted 1950
4 SASI_Hs02_00321148 predicted 1879
5 SASI_Hs02_00321149 predicted 836
6 SASI_Hs02_00321150 predicted 841
7 SASI_Hs02_00321151 predicted 1962
8 SASI_Hs02_00321152 predicted 1647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099694
ZNF578 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 578
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000424312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099694.1-1147s21c1
Sequence:CCGGCCTGACATGCCATCGTAGATGCTCGAGCATCTACGATGGCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099694.1-2070s21c1
Sequence:CCGGAGTCACAGATCACGCCTTAAACTCGAGTTTAAGGCGTGATCTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099694
ZNF578 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 578
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000424312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099694.1-1147s21c1
Sequence:CCGGCCTGACATGCCATCGTAGATGCTCGAGCATCTACGATGGCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099694.1-2070s21c1
Sequence:CCGGAGTCACAGATCACGCCTTAAACTCGAGTTTAAGGCGTGATCTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099694
ZNF578 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 578
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000424312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099694.1-1147s21c1
Sequence:CCGGCCTGACATGCCATCGTAGATGCTCGAGCATCTACGATGGCATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099694.1-2070s21c1
Sequence:CCGGAGTCACAGATCACGCCTTAAACTCGAGTTTAAGGCGTGATCTGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152472
ZNF578 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 578
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1145s1c1
Sequence:CCGGGCTCACAATCACTTGATTGATCTCGAGATCAATCAAGTGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152472.1-2054s1c1
Sequence:CCGGCCCAGCCTGTTTATTATTATTCTCGAGAATAATAATAAACAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1132s1c1
Sequence:CCGGTGAGTGTGGTAAGGCTCACAACTCGAGTTGTGAGCCTTACCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-146s1c1
Sequence:CCGGTGTAGCTCATTTGTAAGGAAACTCGAGTTTCCTTACAAATGAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1068s1c1
Sequence:CCGGTGTGCCATTCTTATCTGGCAACTCGAGTTGCCAGATAAGAATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152472
ZNF578 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 578
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1145s1c1
Sequence:CCGGGCTCACAATCACTTGATTGATCTCGAGATCAATCAAGTGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152472.1-2054s1c1
Sequence:CCGGCCCAGCCTGTTTATTATTATTCTCGAGAATAATAATAAACAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1132s1c1
Sequence:CCGGTGAGTGTGGTAAGGCTCACAACTCGAGTTGTGAGCCTTACCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-146s1c1
Sequence:CCGGTGTAGCTCATTTGTAAGGAAACTCGAGTTTCCTTACAAATGAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1068s1c1
Sequence:CCGGTGTGCCATTCTTATCTGGCAACTCGAGTTGCCAGATAAGAATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152472
ZNF578 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 578
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1145s1c1
Sequence:CCGGGCTCACAATCACTTGATTGATCTCGAGATCAATCAAGTGATTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152472.1-2054s1c1
Sequence:CCGGCCCAGCCTGTTTATTATTATTCTCGAGAATAATAATAAACAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1132s1c1
Sequence:CCGGTGAGTGTGGTAAGGCTCACAACTCGAGTTGTGAGCCTTACCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-146s1c1
Sequence:CCGGTGTAGCTCATTTGTAAGGAAACTCGAGTTTCCTTACAAATGAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152472.1-1068s1c1
Sequence:CCGGTGTGCCATTCTTATCTGGCAACTCGAGTTGCCAGATAAGAATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks