EMAIL THIS PAGE TO A FRIEND

ZNF579

zinc finger protein 579

UniProtKB ID: Q8NAF0
Gene ID:
dog(484293) zinc finger protein 579
cow(618680) zinc finger protein 579
domestic guinea pig(100732431) zinc finger protein 579
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152600 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366447 predicted 1812
2 SASI_Hs01_00243285 predicted 543
3 SASI_Hs01_00243286 predicted 543
4 SASI_Hs01_00243287 predicted 540
5 SASI_Hs01_00243288 predicted 689
6 SASI_Hs01_00243289 predicted 436
7 SASI_Hs01_00243291 predicted 1850
8 SASI_Hs01_00243292 predicted 398
9 SASI_Hs01_00243293 predicted 779
10 SASI_Hs01_00243294 predicted 395
11 SASI_Hs01_00243290 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152600
ZNF579 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 579
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1617s1c1
Sequence:CCGGGCCTCCTGTTTCGACAGCCAACTCGAGTTGGCTGTCGAAACAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-914s1c1
Sequence:CCGGCCGCCCTTTCGTGTGCCCAGACTCGAGTCTGGGCACACGAAAGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1665s1c1
Sequence:CCGGGAAGAGGTAGACAGCAAGGCTCTCGAGAGCCTTGCTGTCTACCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-677s1c1
Sequence:CCGGGCAGGAGGAGAAACAGGTCCTCTCGAGAGGACCTGTTTCTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-746s1c1
Sequence:CCGGCGCCACCAAGGGCGAGCTCAACTCGAGTTGAGCTCGCCCTTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1792s21c1
Sequence:CCGGGAATGGAGGAGGGAAGTTGAACTCGAGTTCAACTTCCCTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1561s21c1
Sequence:CCGGCCCTCGCAAACATTAAGGAAGCTCGAGCTTCCTTAATGTTTGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1955s21c1
Sequence:CCGGGTCTTAAGGCAGGACGACTTGCTCGAGCAAGTCGTCCTGCCTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1663s21c1
Sequence:CCGGACCACTCAGCCTTCGAGATGGCTCGAGCCATCTCGAAGGCTGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1845s21c1
Sequence:CCGGCTTCACGCCCTTGACACTAAGCTCGAGCTTAGTGTCAAGGGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152600
ZNF579 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 579
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1617s1c1
Sequence:CCGGGCCTCCTGTTTCGACAGCCAACTCGAGTTGGCTGTCGAAACAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-914s1c1
Sequence:CCGGCCGCCCTTTCGTGTGCCCAGACTCGAGTCTGGGCACACGAAAGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1665s1c1
Sequence:CCGGGAAGAGGTAGACAGCAAGGCTCTCGAGAGCCTTGCTGTCTACCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-677s1c1
Sequence:CCGGGCAGGAGGAGAAACAGGTCCTCTCGAGAGGACCTGTTTCTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-746s1c1
Sequence:CCGGCGCCACCAAGGGCGAGCTCAACTCGAGTTGAGCTCGCCCTTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1792s21c1
Sequence:CCGGGAATGGAGGAGGGAAGTTGAACTCGAGTTCAACTTCCCTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1561s21c1
Sequence:CCGGCCCTCGCAAACATTAAGGAAGCTCGAGCTTCCTTAATGTTTGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1955s21c1
Sequence:CCGGGTCTTAAGGCAGGACGACTTGCTCGAGCAAGTCGTCCTGCCTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1663s21c1
Sequence:CCGGACCACTCAGCCTTCGAGATGGCTCGAGCCATCTCGAAGGCTGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1845s21c1
Sequence:CCGGCTTCACGCCCTTGACACTAAGCTCGAGCTTAGTGTCAAGGGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152600
ZNF579 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 579
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1617s1c1
Sequence:CCGGGCCTCCTGTTTCGACAGCCAACTCGAGTTGGCTGTCGAAACAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-914s1c1
Sequence:CCGGCCGCCCTTTCGTGTGCCCAGACTCGAGTCTGGGCACACGAAAGGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-1665s1c1
Sequence:CCGGGAAGAGGTAGACAGCAAGGCTCTCGAGAGCCTTGCTGTCTACCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-677s1c1
Sequence:CCGGGCAGGAGGAGAAACAGGTCCTCTCGAGAGGACCTGTTTCTCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152600.1-746s1c1
Sequence:CCGGCGCCACCAAGGGCGAGCTCAACTCGAGTTGAGCTCGCCCTTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1792s21c1
Sequence:CCGGGAATGGAGGAGGGAAGTTGAACTCGAGTTCAACTTCCCTCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1561s21c1
Sequence:CCGGCCCTCGCAAACATTAAGGAAGCTCGAGCTTCCTTAATGTTTGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1955s21c1
Sequence:CCGGGTCTTAAGGCAGGACGACTTGCTCGAGCAAGTCGTCCTGCCTTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152600.2-1663s21c1
Sequence:CCGGACCACTCAGCCTTCGAGATGGCTCGAGCCATCTCGAAGGCTGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152600.2-1845s21c1
Sequence:CCGGCTTCACGCCCTTGACACTAAGCTCGAGCTTAGTGTCAAGGGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks