EMAIL THIS PAGE TO A FRIEND

ZNF57

zinc finger protein 57

Synonyms: ZNF424
Species: Human ZNF57(126295)
UniProtKB ID: Q68EA5, Q8N6R9
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173480 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056881 MISSION® esiRNA esiRNA human ZNF57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368238 predicted 854
2 SASI_Hs02_00368239 predicted 407
3 SASI_Hs01_00044419 predicted 1376
4 SASI_Hs01_00044420 predicted 698
5 SASI_Hs01_00044421 predicted 773
6 SASI_Hs01_00044422 predicted 1668
7 SASI_Hs01_00044423 predicted 717
8 SASI_Hs01_00044424 predicted 799
9 SASI_Hs02_00368240 predicted 1241
10 SASI_Hs01_00044417 predicted 416
11 SASI_Hs01_00044418 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173480
ZNF57 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 57
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1307s21c1
Sequence:CCGGACGCAAGAGCAGCTCTATAAACTCGAGTTTATAGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-775s21c1
Sequence:CCGGTTACCTCTCCCACCACGTAAACTCGAGTTTACGTGGTGGGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1475s21c1
Sequence:CCGGACGCAAGAGCAGCTCCATAAACTCGAGTTTATGGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1266s21c1
Sequence:CCGGTCACTTGGTCCTCAACGTTTACTCGAGTAAACGTTGAGGACCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1459s1c1
Sequence:CCGGCCAGAGCATTCCAAGGTCATTCTCGAGAATGACCTTGGAATGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-438s1c1
Sequence:CCGGGCCATCCATCAAATGCCAGATCTCGAGATCTGGCATTTGATGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-252s1c1
Sequence:CCGGCAGGATATGTACGGGCAAGAACTCGAGTTCTTGCCCGTACATATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1676s1c1
Sequence:CCGGCGAATGTCAGTCATACTCAAACTCGAGTTTGAGTATGACTGACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1291s1c1
Sequence:CCGGCCAGATCATTCCGAGGTCATTCTCGAGAATGACCTCGGAATGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173480
ZNF57 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 57
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1307s21c1
Sequence:CCGGACGCAAGAGCAGCTCTATAAACTCGAGTTTATAGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-775s21c1
Sequence:CCGGTTACCTCTCCCACCACGTAAACTCGAGTTTACGTGGTGGGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1475s21c1
Sequence:CCGGACGCAAGAGCAGCTCCATAAACTCGAGTTTATGGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1266s21c1
Sequence:CCGGTCACTTGGTCCTCAACGTTTACTCGAGTAAACGTTGAGGACCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1459s1c1
Sequence:CCGGCCAGAGCATTCCAAGGTCATTCTCGAGAATGACCTTGGAATGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-438s1c1
Sequence:CCGGGCCATCCATCAAATGCCAGATCTCGAGATCTGGCATTTGATGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-252s1c1
Sequence:CCGGCAGGATATGTACGGGCAAGAACTCGAGTTCTTGCCCGTACATATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1676s1c1
Sequence:CCGGCGAATGTCAGTCATACTCAAACTCGAGTTTGAGTATGACTGACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1291s1c1
Sequence:CCGGCCAGATCATTCCGAGGTCATTCTCGAGAATGACCTCGGAATGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173480
ZNF57 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 57
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1307s21c1
Sequence:CCGGACGCAAGAGCAGCTCTATAAACTCGAGTTTATAGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-775s21c1
Sequence:CCGGTTACCTCTCCCACCACGTAAACTCGAGTTTACGTGGTGGGAGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1475s21c1
Sequence:CCGGACGCAAGAGCAGCTCCATAAACTCGAGTTTATGGAGCTGCTCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173480.2-1266s21c1
Sequence:CCGGTCACTTGGTCCTCAACGTTTACTCGAGTAAACGTTGAGGACCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1459s1c1
Sequence:CCGGCCAGAGCATTCCAAGGTCATTCTCGAGAATGACCTTGGAATGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-438s1c1
Sequence:CCGGGCCATCCATCAAATGCCAGATCTCGAGATCTGGCATTTGATGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-252s1c1
Sequence:CCGGCAGGATATGTACGGGCAAGAACTCGAGTTCTTGCCCGTACATATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1676s1c1
Sequence:CCGGCGAATGTCAGTCATACTCAAACTCGAGTTTGAGTATGACTGACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173480.1-1291s1c1
Sequence:CCGGCCAGATCATTCCGAGGTCATTCTCGAGAATGACCTCGGAATGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks