EMAIL THIS PAGE TO A FRIEND

ZNF580

zinc finger protein 580

UniProtKB ID: Q9UK33, B2RC05, Q9NPP7
Gene ID:
domestic guinea pig(100733554) zinc finger protein 580
naked mole-rat(101696849) zinc finger protein 580
cow(507619) zinc finger protein 580
domestic cat(101088286) zinc finger protein 580
dog(611259) zinc finger protein 580
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226641 MISSION® esiRNA esiRNA targeting human ZNF580 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016202 Rosetta Predictions human pricing
NM_207115 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349040 predicted 1386
2 SASI_Hs01_00174996 predicted 1147
3 SASI_Hs02_00349041 predicted 734
4 SASI_Hs02_00349042 predicted 748
5 SASI_Hs02_00349043 predicted 785
6 SASI_Hs01_00175000 predicted 1151
7 SASI_Hs02_00349044 predicted 1331
8 SASI_Hs02_00349045 predicted 785
9 SASI_Hs02_00349046 predicted 737
10 SASI_Hs01_00175002 predicted 638
11 SASI_Hs01_00174997 predicted 1085
12 SASI_Hs01_00174998 predicted 807
13 SASI_Hs01_00174999 predicted 1119
14 SASI_Hs01_00175001 predicted 1393
15 SASI_Hs01_00175003 predicted 1112
16 SASI_Hs01_00175004 predicted 1029
17 SASI_Hs01_00175005 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182153 predicted 858
2 SASI_Hs01_00182155 predicted 523
3 SASI_Hs02_00373752 predicted 831
4 SASI_Hs01_00182158 predicted 864
5 SASI_Hs02_00373753 predicted 1099
6 SASI_Hs02_00373754 predicted 352
7 SASI_Hs02_00373755 predicted 816
8 SASI_Hs02_00373756 predicted 741
9 SASI_Hs02_00373757 predicted 723
10 SASI_Hs02_00373758 predicted 777
11 SASI_Hs01_00182152 predicted 1097
12 SASI_Hs01_00182154 predicted 449
13 SASI_Hs01_00182156 predicted 459
14 SASI_Hs01_00182157 predicted 501
15 SASI_Hs01_00182159 predicted 1042
16 SASI_Hs01_00182160 predicted 505
17 SASI_Hs01_00182161 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016202
VALIDATED
ZNF580 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 580
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1154s21c1
Sequence:CCGGGCTGTGTGATGTAGACCAAAGCTCGAGCTTTGGTCTACATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1114s21c1
Sequence:CCGGCCAAAGGGAGGAGCATCATTCCTCGAGGAATGATGCTCCTCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-615s21c1
Sequence:CCGGACCTCCTCATCGACGCCAATGCTCGAGCATTGGCGTCGATGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1069s21c1
Sequence:CCGGCTGCTGAGGTTACTGCCTTACCTCGAGGTAAGGCAGTAACCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1249s21c1
Sequence:CCGGAGTGACATGACCTCTCTAAACCTCGAGGTTTAGAGAGGTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-643s1c1
Sequence:CCGGCTACACATACACGGTGCAGCTCTCGAGAGCTGCACCGTGTATGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-749s1c1
Sequence:CCGGGCCCGTGTCTTTGCCAGCCCTCTCGAGAGGGCTGGCAAAGACACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-955s1c1
Sequence:CCGGGCAGCACGTGCGCCTCCACTACTCGAGTAGTGGAGGCGCACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-851s1c1
Sequence:CCGGTCCAGCCACCTGTCGCGGCATCTCGAGATGCCGCGACAGGTGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016202
VALIDATED
ZNF580 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 580
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1154s21c1
Sequence:CCGGGCTGTGTGATGTAGACCAAAGCTCGAGCTTTGGTCTACATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1114s21c1
Sequence:CCGGCCAAAGGGAGGAGCATCATTCCTCGAGGAATGATGCTCCTCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-615s21c1
Sequence:CCGGACCTCCTCATCGACGCCAATGCTCGAGCATTGGCGTCGATGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1069s21c1
Sequence:CCGGCTGCTGAGGTTACTGCCTTACCTCGAGGTAAGGCAGTAACCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1249s21c1
Sequence:CCGGAGTGACATGACCTCTCTAAACCTCGAGGTTTAGAGAGGTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-643s1c1
Sequence:CCGGCTACACATACACGGTGCAGCTCTCGAGAGCTGCACCGTGTATGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-749s1c1
Sequence:CCGGGCCCGTGTCTTTGCCAGCCCTCTCGAGAGGGCTGGCAAAGACACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-955s1c1
Sequence:CCGGGCAGCACGTGCGCCTCCACTACTCGAGTAGTGGAGGCGCACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-851s1c1
Sequence:CCGGTCCAGCCACCTGTCGCGGCATCTCGAGATGCCGCGACAGGTGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016202
VALIDATED
ZNF580 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 580
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1154s21c1
Sequence:CCGGGCTGTGTGATGTAGACCAAAGCTCGAGCTTTGGTCTACATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1114s21c1
Sequence:CCGGCCAAAGGGAGGAGCATCATTCCTCGAGGAATGATGCTCCTCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-615s21c1
Sequence:CCGGACCTCCTCATCGACGCCAATGCTCGAGCATTGGCGTCGATGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1069s21c1
Sequence:CCGGCTGCTGAGGTTACTGCCTTACCTCGAGGTAAGGCAGTAACCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016202.2-1249s21c1
Sequence:CCGGAGTGACATGACCTCTCTAAACCTCGAGGTTTAGAGAGGTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-643s1c1
Sequence:CCGGCTACACATACACGGTGCAGCTCTCGAGAGCTGCACCGTGTATGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-749s1c1
Sequence:CCGGGCCCGTGTCTTTGCCAGCCCTCTCGAGAGGGCTGGCAAAGACACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016202.1-955s1c1
Sequence:CCGGGCAGCACGTGCGCCTCCACTACTCGAGTAGTGGAGGCGCACGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016202.1-851s1c1
Sequence:CCGGTCCAGCCACCTGTCGCGGCATCTCGAGATGCCGCGACAGGTGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks