EMAIL THIS PAGE TO A FRIEND

ZNF581

zinc finger protein 581

UniProtKB ID: Q9P0T4, B2RDM6
Gene ID:
dog(611254) zinc finger protein 581
domestic cat(101083222) zinc finger protein 581
cow(618894) zinc finger protein 581
sheep(101119843) zinc finger protein 581
naked mole-rat(101697456) zinc finger protein 581
domestic guinea pig(100713145) zinc finger protein 581
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016535 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023741 MISSION® esiRNA esiRNA human ZNF581 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016535 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240666 predicted 555
2 SASI_Hs01_00240667 predicted 973
3 SASI_Hs01_00240668 predicted 908
4 SASI_Hs01_00240669 predicted 875
5 SASI_Hs01_00240670 predicted 316
6 SASI_Hs01_00240671 predicted 679
7 SASI_Hs01_00240672 predicted 906
8 SASI_Hs01_00240673 predicted 443
9 SASI_Hs01_00240675 predicted 539
10 SASI_Hs02_00349640 predicted 319
11 SASI_Hs01_00240674 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016535
ZNF581 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 581
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016535.3-915s1c1
Sequence:CCGGGAAGGAGGAATCCGTGAGTAACTCGAGTTACTCACGGATTCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-738s1c1
Sequence:CCGGGCAGAAACACACGCGGTGGAACTCGAGTTCCACCGCGTGTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-450s1c1
Sequence:CCGGCTCAAGGGTCTTCGAGTACATCTCGAGATGTACTCGAAGACCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-299s1c1
Sequence:CCGGCCCAGGCTTCATCTCCTCCAACTCGAGTTGGAGGAGATGAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-322s1c1
Sequence:CCGGCCCAACCACTACCTGCTTATTCTCGAGAATAAGCAGGTAGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-702s21c1
Sequence:CCGGACACTGCCCTCGCCGCTTTATCTCGAGATAAAGCGGCGAGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-1066s21c1
Sequence:CCGGTAAAGTCTCTGGCCTCATAAACTCGAGTTTATGAGGCCAGAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-492s21c1
Sequence:CCGGCATCACCCACTCGGAGGTAAACTCGAGTTTACCTCCGAGTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-879s21c1
Sequence:CCGGACAGAGCAGCCGCATCTCAAACTCGAGTTTGAGATGCGGCTGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016535
ZNF581 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 581
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016535.3-915s1c1
Sequence:CCGGGAAGGAGGAATCCGTGAGTAACTCGAGTTACTCACGGATTCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-738s1c1
Sequence:CCGGGCAGAAACACACGCGGTGGAACTCGAGTTCCACCGCGTGTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-450s1c1
Sequence:CCGGCTCAAGGGTCTTCGAGTACATCTCGAGATGTACTCGAAGACCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-299s1c1
Sequence:CCGGCCCAGGCTTCATCTCCTCCAACTCGAGTTGGAGGAGATGAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-322s1c1
Sequence:CCGGCCCAACCACTACCTGCTTATTCTCGAGAATAAGCAGGTAGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-702s21c1
Sequence:CCGGACACTGCCCTCGCCGCTTTATCTCGAGATAAAGCGGCGAGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-1066s21c1
Sequence:CCGGTAAAGTCTCTGGCCTCATAAACTCGAGTTTATGAGGCCAGAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-492s21c1
Sequence:CCGGCATCACCCACTCGGAGGTAAACTCGAGTTTACCTCCGAGTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-879s21c1
Sequence:CCGGACAGAGCAGCCGCATCTCAAACTCGAGTTTGAGATGCGGCTGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016535
ZNF581 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 581
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016535.3-915s1c1
Sequence:CCGGGAAGGAGGAATCCGTGAGTAACTCGAGTTACTCACGGATTCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-738s1c1
Sequence:CCGGGCAGAAACACACGCGGTGGAACTCGAGTTCCACCGCGTGTGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-450s1c1
Sequence:CCGGCTCAAGGGTCTTCGAGTACATCTCGAGATGTACTCGAAGACCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-299s1c1
Sequence:CCGGCCCAGGCTTCATCTCCTCCAACTCGAGTTGGAGGAGATGAAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016535.3-322s1c1
Sequence:CCGGCCCAACCACTACCTGCTTATTCTCGAGAATAAGCAGGTAGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-702s21c1
Sequence:CCGGACACTGCCCTCGCCGCTTTATCTCGAGATAAAGCGGCGAGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-1066s21c1
Sequence:CCGGTAAAGTCTCTGGCCTCATAAACTCGAGTTTATGAGGCCAGAGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016535.3-492s21c1
Sequence:CCGGCATCACCCACTCGGAGGTAAACTCGAGTTTACCTCCGAGTGGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016535.3-879s21c1
Sequence:CCGGACAGAGCAGCCGCATCTCAAACTCGAGTTTGAGATGCGGCTGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks