EMAIL THIS PAGE TO A FRIEND

ZNF582

zinc finger protein 582

UniProtKB ID: Q96NG8, Q6PJT6
Gene ID:
domestic guinea pig(100715362) zinc finger protein 582
cow(790311) zinc finger protein 582
sheep(101105520) zinc finger protein 582
Horse(100057680) zinc finger protein 582
domestic cat(101096122) zinc finger protein 582
dog(100686346) zinc finger protein 582
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144690 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024361 MISSION® esiRNA esiRNA human ZNF582 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144690 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175714 predicted 525
2 SASI_Hs01_00175715 predicted 1664
3 SASI_Hs01_00175716 predicted 1691
4 SASI_Hs01_00175717 predicted 486
5 SASI_Hs01_00175718 predicted 1784
6 SASI_Hs01_00175719 predicted 477
7 SASI_Hs02_00364611 predicted 559
8 SASI_Hs01_00175721 predicted 1463
9 SASI_Hs02_00364612 predicted 500
10 SASI_Hs01_00175722 predicted 789
11 SASI_Hs01_00175720 predicted 548
12 SASI_Hs01_00175723 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144690
ZNF582 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 582
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144690.1-1771s1c1
Sequence:CCGGGCCAGTGACAATGCCTTCATTCTCGAGAATGAAGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1039s1c1
Sequence:CCGGCGGATCTCACATCTTAAAGTACTCGAGTACTTTAAGATGTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-433s1c1
Sequence:CCGGCAGCATGTTTATGAAGTCGAACTCGAGTTCGACTTCATAAACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1483s1c1
Sequence:CCGGCAGGTTATTCACACTGAGAAACTCGAGTTTCTCAGTGTGAATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-193s1c1
Sequence:CCGGGCCATAGTCTTCTCCCAAGAACTCGAGTTCTTGGGAGAAGACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144690
ZNF582 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 582
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144690.1-1771s1c1
Sequence:CCGGGCCAGTGACAATGCCTTCATTCTCGAGAATGAAGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1039s1c1
Sequence:CCGGCGGATCTCACATCTTAAAGTACTCGAGTACTTTAAGATGTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-433s1c1
Sequence:CCGGCAGCATGTTTATGAAGTCGAACTCGAGTTCGACTTCATAAACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1483s1c1
Sequence:CCGGCAGGTTATTCACACTGAGAAACTCGAGTTTCTCAGTGTGAATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-193s1c1
Sequence:CCGGGCCATAGTCTTCTCCCAAGAACTCGAGTTCTTGGGAGAAGACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144690
ZNF582 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 582
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144690.1-1771s1c1
Sequence:CCGGGCCAGTGACAATGCCTTCATTCTCGAGAATGAAGGCATTGTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1039s1c1
Sequence:CCGGCGGATCTCACATCTTAAAGTACTCGAGTACTTTAAGATGTGAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-433s1c1
Sequence:CCGGCAGCATGTTTATGAAGTCGAACTCGAGTTCGACTTCATAAACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-1483s1c1
Sequence:CCGGCAGGTTATTCACACTGAGAAACTCGAGTTTCTCAGTGTGAATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144690.1-193s1c1
Sequence:CCGGGCCATAGTCTTCTCCCAAGAACTCGAGTTCTTGGGAGAAGACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks