EMAIL THIS PAGE TO A FRIEND

ZNF583

zinc finger protein 583

UniProtKB ID: Q96ND8, O14850, Q2NKK3
Gene ID:
dog(484282) zinc finger protein 583
domestic cat(101080416) zinc finger protein 583
Horse(100057639) zinc finger protein 583
cow(789836) zinc finger protein 583
sheep(101110171) zinc finger protein 583
domestic guinea pig(101788406) zinc finger protein 583
naked mole-rat(101722053) zinc finger protein 583
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152478 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136844 predicted 687
2 SASI_Hs01_00136845 predicted 674
3 SASI_Hs01_00136846 predicted 943
4 SASI_Hs01_00136847 predicted 691
5 SASI_Hs01_00136848 predicted 605
6 SASI_Hs01_00136849 predicted 1281
7 SASI_Hs01_00136850 predicted 347
8 SASI_Hs01_00136851 predicted 949
9 SASI_Hs01_00136852 predicted 1360
10 SASI_Hs01_00136853 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152478
ZNF583 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 583
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-1187s1c1
Sequence:CCGGGCCTTTAGTAATGGTTCATTTCTCGAGAAATGAACCATTACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-797s1c1
Sequence:CCGGCATAGGAAAGTCTATGTAGAACTCGAGTTCTACATAGACTTTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-420s1c1
Sequence:CCGGGCCCTGATTGGGAGTATGTATCTCGAGATACATACTCCCAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-315s1c1
Sequence:CCGGGCTTGGTATCATTGGGAGTTTCTCGAGAAACTCCCAATGATACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-707s21c1
Sequence:CCGGACATTCCACCAGGATACAATCCTCGAGGATTGTATCCTGGTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-974s21c1
Sequence:CCGGGCAAACTTGGCGCAACATAAGCTCGAGCTTATGTTGCGCCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-530s21c1
Sequence:CCGGGGAGCAAGACATCTTAGTTATCTCGAGATAACTAAGATGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-624s21c1
Sequence:CCGGAGGTACATCTTAGTCAATTAACTCGAGTTAATTGACTAAGATGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152478
ZNF583 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 583
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-1187s1c1
Sequence:CCGGGCCTTTAGTAATGGTTCATTTCTCGAGAAATGAACCATTACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-797s1c1
Sequence:CCGGCATAGGAAAGTCTATGTAGAACTCGAGTTCTACATAGACTTTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-420s1c1
Sequence:CCGGGCCCTGATTGGGAGTATGTATCTCGAGATACATACTCCCAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-315s1c1
Sequence:CCGGGCTTGGTATCATTGGGAGTTTCTCGAGAAACTCCCAATGATACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-707s21c1
Sequence:CCGGACATTCCACCAGGATACAATCCTCGAGGATTGTATCCTGGTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-974s21c1
Sequence:CCGGGCAAACTTGGCGCAACATAAGCTCGAGCTTATGTTGCGCCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-530s21c1
Sequence:CCGGGGAGCAAGACATCTTAGTTATCTCGAGATAACTAAGATGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-624s21c1
Sequence:CCGGAGGTACATCTTAGTCAATTAACTCGAGTTAATTGACTAAGATGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152478
ZNF583 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 583
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-1187s1c1
Sequence:CCGGGCCTTTAGTAATGGTTCATTTCTCGAGAAATGAACCATTACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-797s1c1
Sequence:CCGGCATAGGAAAGTCTATGTAGAACTCGAGTTCTACATAGACTTTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-420s1c1
Sequence:CCGGGCCCTGATTGGGAGTATGTATCTCGAGATACATACTCCCAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152478.1-315s1c1
Sequence:CCGGGCTTGGTATCATTGGGAGTTTCTCGAGAAACTCCCAATGATACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-707s21c1
Sequence:CCGGACATTCCACCAGGATACAATCCTCGAGGATTGTATCCTGGTGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-974s21c1
Sequence:CCGGGCAAACTTGGCGCAACATAAGCTCGAGCTTATGTTGCGCCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-530s21c1
Sequence:CCGGGGAGCAAGACATCTTAGTTATCTCGAGATAACTAAGATGTCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152478.2-624s21c1
Sequence:CCGGAGGTACATCTTAGTCAATTAACTCGAGTTAATTGACTAAGATGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks