EMAIL THIS PAGE TO A FRIEND

ZNF584

zinc finger protein 584

UniProtKB ID: Q8IVC4, A8K203
Gene ID:
naked mole-rat(101705141) zinc finger protein 584
domestic guinea pig(100728789) zinc finger protein 584
cow(531064) zinc finger protein 584
sheep(101119929) zinc finger protein 584
dog(100684391) zinc finger protein 584
domestic cat(101089729) zinc finger protein 584
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173548 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040089 predicted 1468
2 SASI_Hs01_00040090 predicted 1073
3 SASI_Hs01_00040091 predicted 496
4 SASI_Hs01_00040092 predicted 880
5 SASI_Hs01_00040093 predicted 481
6 SASI_Hs01_00040094 predicted 890
7 SASI_Hs01_00040095 predicted 515
8 SASI_Hs01_00040096 predicted 1572
9 SASI_Hs01_00040097 predicted 1202
10 SASI_Hs02_00368355 predicted 1786
11 SASI_Hs01_00040098 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173548
VALIDATED
ZNF584 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 584
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-1039s21c1
Sequence:CCGGTCAAGAAGTCAGCTCATATTACTCGAGTAATATGAGCTGACTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-508s21c1
Sequence:CCGGTTGAGGATGTGACGGTATATTCTCGAGAATATACCGTCACATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-773s21c1
Sequence:CCGGAGCCCATCCTGAGCATCTAAACTCGAGTTTAGATGCTCAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173548.1-1859s21c1
Sequence:CCGGGACGCTTTCGGGACCCATATTCTCGAGAATATGGGTCCCGAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-970s21c1
Sequence:CCGGCCCTCCTTGACCATCTGATAACTCGAGTTATCAGATGGTCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-548s1c1
Sequence:CCGGGCTCCTTAATGTGACCCAGAACTCGAGTTCTGGGTCACATTAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-1149s1c1
Sequence:CCGGCAGAAGGTTCACACAGGCATACTCGAGTATGCCTGTGTGAACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_173548.1-1638s1c1
Sequence:CCGGACCCTCCTTCAGCACAAGAAACTCGAGTTTCTTGTGCTGAAGGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173548
VALIDATED
ZNF584 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 584
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-1039s21c1
Sequence:CCGGTCAAGAAGTCAGCTCATATTACTCGAGTAATATGAGCTGACTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-508s21c1
Sequence:CCGGTTGAGGATGTGACGGTATATTCTCGAGAATATACCGTCACATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-773s21c1
Sequence:CCGGAGCCCATCCTGAGCATCTAAACTCGAGTTTAGATGCTCAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173548.1-1859s21c1
Sequence:CCGGGACGCTTTCGGGACCCATATTCTCGAGAATATGGGTCCCGAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-970s21c1
Sequence:CCGGCCCTCCTTGACCATCTGATAACTCGAGTTATCAGATGGTCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-548s1c1
Sequence:CCGGGCTCCTTAATGTGACCCAGAACTCGAGTTCTGGGTCACATTAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-1149s1c1
Sequence:CCGGCAGAAGGTTCACACAGGCATACTCGAGTATGCCTGTGTGAACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_173548.1-1638s1c1
Sequence:CCGGACCCTCCTTCAGCACAAGAAACTCGAGTTTCTTGTGCTGAAGGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173548
VALIDATED
ZNF584 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 584
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-1039s21c1
Sequence:CCGGTCAAGAAGTCAGCTCATATTACTCGAGTAATATGAGCTGACTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-508s21c1
Sequence:CCGGTTGAGGATGTGACGGTATATTCTCGAGAATATACCGTCACATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-773s21c1
Sequence:CCGGAGCCCATCCTGAGCATCTAAACTCGAGTTTAGATGCTCAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173548.1-1859s21c1
Sequence:CCGGGACGCTTTCGGGACCCATATTCTCGAGAATATGGGTCCCGAAAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173548.1-970s21c1
Sequence:CCGGCCCTCCTTGACCATCTGATAACTCGAGTTATCAGATGGTCAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-548s1c1
Sequence:CCGGGCTCCTTAATGTGACCCAGAACTCGAGTTCTGGGTCACATTAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173548.1-1149s1c1
Sequence:CCGGCAGAAGGTTCACACAGGCATACTCGAGTATGCCTGTGTGAACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_173548.1-1638s1c1
Sequence:CCGGACCCTCCTTCAGCACAAGAAACTCGAGTTTCTTGTGCTGAAGGAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks