EMAIL THIS PAGE TO A FRIEND

ZNF585A

zinc finger protein 585A

UniProtKB ID: Q6P3V2, Q8TE95, Q96MV3
Gene ID:
dog(484540) zinc finger protein 585A
domestic cat(101082029) zinc finger protein 585A
cow(767967) zinc finger protein 585A
cow(786931) zinc finger protein 585A
sheep(101122971) zinc finger protein 585A
Domestic Rabbit(100346269) zinc finger protein 585A
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152655 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152655 Rosetta Predictions human pricing
NM_199126 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030469 predicted 635
2 SASI_Hs01_00030470 predicted 2601
3 SASI_Hs01_00030471 predicted 756
4 SASI_Hs01_00030472 predicted 669
5 SASI_Hs01_00030473 predicted 968
6 SASI_Hs01_00030476 predicted 740
7 SASI_Hs01_00030477 predicted 772
8 SASI_Hs01_00030478 predicted 1172
9 SASI_Hs01_00030475 predicted 1219
10 SASI_Hs01_00030474 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192164 predicted 595
2 SASI_Hs01_00192165 predicted 2566
3 SASI_Hs01_00192166 predicted 723
4 SASI_Hs01_00192167 predicted 640
5 SASI_Hs01_00192168 predicted 927
6 SASI_Hs01_00192171 predicted 700
7 SASI_Hs01_00192172 predicted 741
8 SASI_Hs01_00192173 predicted 1142
9 SASI_Hs01_00192170 predicted 1178
10 SASI_Hs01_00192169 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152655
ZNF585A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 585A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152655.2-3956s1c1
Sequence:CCGGGCAGTATCTAACTGTCCCTAACTCGAGTTAGGGACAGTTAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1170s1c1
Sequence:CCGGCATCCAGAAGACCCATTTGATCTCGAGATCAAATGGGTCTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-714s1c1
Sequence:CCGGGAAAGCTTATGAATGCGCCAACTCGAGTTGGCGCATTCATAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-843s1c1
Sequence:CCGGGCCAGAATTTATTATACACCACTCGAGTGGTGTATAATAAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1354s1c1
Sequence:CCGGCTCGTTACACATAAGAAAGTTCTCGAGAACTTTCTTATGTGTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152655.2-3001s21c1
Sequence:CCGGTGCCAACAAATTGAATGATAACTCGAGTTATCATTCAATTTGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152655.2-1683s21c1
Sequence:CCGGGTCGCAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152655
ZNF585A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 585A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152655.2-3956s1c1
Sequence:CCGGGCAGTATCTAACTGTCCCTAACTCGAGTTAGGGACAGTTAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1170s1c1
Sequence:CCGGCATCCAGAAGACCCATTTGATCTCGAGATCAAATGGGTCTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-714s1c1
Sequence:CCGGGAAAGCTTATGAATGCGCCAACTCGAGTTGGCGCATTCATAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-843s1c1
Sequence:CCGGGCCAGAATTTATTATACACCACTCGAGTGGTGTATAATAAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1354s1c1
Sequence:CCGGCTCGTTACACATAAGAAAGTTCTCGAGAACTTTCTTATGTGTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152655.2-3001s21c1
Sequence:CCGGTGCCAACAAATTGAATGATAACTCGAGTTATCATTCAATTTGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152655.2-1683s21c1
Sequence:CCGGGTCGCAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152655
ZNF585A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 585A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152655.2-3956s1c1
Sequence:CCGGGCAGTATCTAACTGTCCCTAACTCGAGTTAGGGACAGTTAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1170s1c1
Sequence:CCGGCATCCAGAAGACCCATTTGATCTCGAGATCAAATGGGTCTTCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-714s1c1
Sequence:CCGGGAAAGCTTATGAATGCGCCAACTCGAGTTGGCGCATTCATAAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-843s1c1
Sequence:CCGGGCCAGAATTTATTATACACCACTCGAGTGGTGTATAATAAATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152655.2-1354s1c1
Sequence:CCGGCTCGTTACACATAAGAAAGTTCTCGAGAACTTTCTTATGTGTAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152655.2-3001s21c1
Sequence:CCGGTGCCAACAAATTGAATGATAACTCGAGTTATCATTCAATTTGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152655.2-1683s21c1
Sequence:CCGGGTCGCAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks