EMAIL THIS PAGE TO A FRIEND

ZNF585B

zinc finger protein 585B

Synonyms: SZFP41
Species: Human ZNF585B(92285), Domestic Rabbit ZNF585B(100346527)
UniProtKB ID: Q52M93, Q8IZD3, Q96JW6
Gene ID:
Domestic Rabbit(100346527) zinc finger protein 585B
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157439 predicted 559
2 SASI_Hs01_00157440 predicted 681
3 SASI_Hs01_00157441 predicted 2529
4 SASI_Hs01_00157442 predicted 1138
5 SASI_Hs01_00157443 predicted 1272
6 SASI_Hs01_00157444 predicted 1269
7 SASI_Hs01_00157445 predicted 2534
8 SASI_Hs01_00157446 predicted 2427
9 SASI_Hs01_00157447 predicted 679
10 SASI_Hs01_00157448 predicted 2430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152279
ZNF585B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 585B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1280s21c1
Sequence:CCGGTACACATGAGAAGATTCAAAGCTCGAGCTTTGAATCTTCTCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1604s21c1
Sequence:CCGGGTCACAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1926s1c1
Sequence:CCGGGCCTTCAACCAGAAATCAATACTCGAGTATTGATTTCTGGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1686s1c1
Sequence:CCGGCGGTCAAATCTCATTACACATCTCGAGATGTGTAATGAGATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-2430s1c1
Sequence:CCGGGCCTTTAGCAACAGGTCCAATCTCGAGATTGGACCTGTTGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-549s1c1
Sequence:CCGGGAGAAATTATGGGACCATAATCTCGAGATTATGGTCCCATAATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1226s1c1
Sequence:CCGGGCCCTATATATGTACCGAATACTCGAGTATTCGGTACATATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152279
ZNF585B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 585B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1280s21c1
Sequence:CCGGTACACATGAGAAGATTCAAAGCTCGAGCTTTGAATCTTCTCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1604s21c1
Sequence:CCGGGTCACAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1926s1c1
Sequence:CCGGGCCTTCAACCAGAAATCAATACTCGAGTATTGATTTCTGGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1686s1c1
Sequence:CCGGCGGTCAAATCTCATTACACATCTCGAGATGTGTAATGAGATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-2430s1c1
Sequence:CCGGGCCTTTAGCAACAGGTCCAATCTCGAGATTGGACCTGTTGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-549s1c1
Sequence:CCGGGAGAAATTATGGGACCATAATCTCGAGATTATGGTCCCATAATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1226s1c1
Sequence:CCGGGCCCTATATATGTACCGAATACTCGAGTATTCGGTACATATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152279
ZNF585B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 585B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1280s21c1
Sequence:CCGGTACACATGAGAAGATTCAAAGCTCGAGCTTTGAATCTTCTCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152279.2-1604s21c1
Sequence:CCGGGTCACAACTCCATGTTCATAACTCGAGTTATGAACATGGAGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1926s1c1
Sequence:CCGGGCCTTCAACCAGAAATCAATACTCGAGTATTGATTTCTGGTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1686s1c1
Sequence:CCGGCGGTCAAATCTCATTACACATCTCGAGATGTGTAATGAGATTTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-2430s1c1
Sequence:CCGGGCCTTTAGCAACAGGTCCAATCTCGAGATTGGACCTGTTGCTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-549s1c1
Sequence:CCGGGAGAAATTATGGGACCATAATCTCGAGATTATGGTCCCATAATTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152279.2-1226s1c1
Sequence:CCGGGCCCTATATATGTACCGAATACTCGAGTATTCGGTACATATATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks