EMAIL THIS PAGE TO A FRIEND

ZNF586

zinc finger protein 586

Species: Human ZNF586(54807)
UniProtKB ID: Q9NXT0, A0JLV8, A8MY63, B3KTS9, E7ERT1, G3XAH3
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017652 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115560 predicted 824
2 SASI_Hs02_00350354 predicted 1381
3 SASI_Hs02_00350355 predicted 1428
4 SASI_Hs01_00115563 predicted 591
5 SASI_Hs01_00115566 predicted 505
6 SASI_Hs02_00350356 predicted 1254
7 SASI_Hs01_00115565 predicted 824
8 SASI_Hs01_00115559 predicted 548
9 SASI_Hs01_00115561 predicted 448
10 SASI_Hs01_00115562 predicted 744
11 SASI_Hs01_00115564 predicted 826
12 SASI_Hs01_00115567 predicted 367
13 SASI_Hs01_00115568 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017652
ZNF586 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 586
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-818s1c1
Sequence:CCGGGCTTATACATCTAGTCTCATTCTCGAGAATGAGACTAGATGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-377s1c1
Sequence:CCGGGCAGAGCACGTGTATACATATCTCGAGATATGTATACACGTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-544s1c1
Sequence:CCGGGCAGCAAATATGGGAAATTATCTCGAGATAATTTCCCATATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-649s1c1
Sequence:CCGGTCACCAAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTTGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-749s1c1
Sequence:CCGGCTCATTAACCACAGGAAAGTTCTCGAGAACTTTCCTGTGGTTAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1630s21c1
Sequence:CCGGCACAGATGTGGAGGTAATATTCTCGAGAATATTACCTCCACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-322s21c1
Sequence:CCGGGAGACCTTGACACTTATATCCCTCGAGGGATATAAGTGTCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-999s21c1
Sequence:CCGGTCGCCGAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTCGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-525s21c1
Sequence:CCGGGAATGTTCGCACTGGAGAAAGCTCGAGCTTTCTCCAGTGCGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-693s21c1
Sequence:CCGGGACACTTCACACTAGAGAAAGCTCGAGCTTTCTCTAGTGTGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1749s21c1
Sequence:CCGGTGTGGGAACTGCATAGTATTTCTCGAGAAATACTATGCAGTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-220s21c1
Sequence:CCGGCAGAGCAGTGTGACCTTTGAACTCGAGTTCAAAGGTCACACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-785s21c1
Sequence:CCGGACTCTGGAGCAAAGCGTTATGCTCGAGCATAACGCTTTGCTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1594s21c1
Sequence:CCGGTCATTGGTTACCACAATATTTCTCGAGAAATATTGTGGTAACCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-499s21c1
Sequence:CCGGGAACCCAGAAGAGATCACAAACTCGAGTTTGTGATCTCTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017652
ZNF586 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 586
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-818s1c1
Sequence:CCGGGCTTATACATCTAGTCTCATTCTCGAGAATGAGACTAGATGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-377s1c1
Sequence:CCGGGCAGAGCACGTGTATACATATCTCGAGATATGTATACACGTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-544s1c1
Sequence:CCGGGCAGCAAATATGGGAAATTATCTCGAGATAATTTCCCATATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-649s1c1
Sequence:CCGGTCACCAAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTTGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-749s1c1
Sequence:CCGGCTCATTAACCACAGGAAAGTTCTCGAGAACTTTCCTGTGGTTAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1630s21c1
Sequence:CCGGCACAGATGTGGAGGTAATATTCTCGAGAATATTACCTCCACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-322s21c1
Sequence:CCGGGAGACCTTGACACTTATATCCCTCGAGGGATATAAGTGTCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-999s21c1
Sequence:CCGGTCGCCGAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTCGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-525s21c1
Sequence:CCGGGAATGTTCGCACTGGAGAAAGCTCGAGCTTTCTCCAGTGCGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-693s21c1
Sequence:CCGGGACACTTCACACTAGAGAAAGCTCGAGCTTTCTCTAGTGTGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1749s21c1
Sequence:CCGGTGTGGGAACTGCATAGTATTTCTCGAGAAATACTATGCAGTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-220s21c1
Sequence:CCGGCAGAGCAGTGTGACCTTTGAACTCGAGTTCAAAGGTCACACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-785s21c1
Sequence:CCGGACTCTGGAGCAAAGCGTTATGCTCGAGCATAACGCTTTGCTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1594s21c1
Sequence:CCGGTCATTGGTTACCACAATATTTCTCGAGAAATATTGTGGTAACCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-499s21c1
Sequence:CCGGGAACCCAGAAGAGATCACAAACTCGAGTTTGTGATCTCTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017652
ZNF586 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 586
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-818s1c1
Sequence:CCGGGCTTATACATCTAGTCTCATTCTCGAGAATGAGACTAGATGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-377s1c1
Sequence:CCGGGCAGAGCACGTGTATACATATCTCGAGATATGTATACACGTGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-544s1c1
Sequence:CCGGGCAGCAAATATGGGAAATTATCTCGAGATAATTTCCCATATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-649s1c1
Sequence:CCGGTCACCAAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTTGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017652.1-749s1c1
Sequence:CCGGCTCATTAACCACAGGAAAGTTCTCGAGAACTTTCCTGTGGTTAATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1630s21c1
Sequence:CCGGCACAGATGTGGAGGTAATATTCTCGAGAATATTACCTCCACATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-322s21c1
Sequence:CCGGGAGACCTTGACACTTATATCCCTCGAGGGATATAAGTGTCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-999s21c1
Sequence:CCGGTCGCCGAAGCTCTTCACTCTTCTCGAGAAGAGTGAAGAGCTTCGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-525s21c1
Sequence:CCGGGAATGTTCGCACTGGAGAAAGCTCGAGCTTTCTCCAGTGCGAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-693s21c1
Sequence:CCGGGACACTTCACACTAGAGAAAGCTCGAGCTTTCTCTAGTGTGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1749s21c1
Sequence:CCGGTGTGGGAACTGCATAGTATTTCTCGAGAAATACTATGCAGTTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-220s21c1
Sequence:CCGGCAGAGCAGTGTGACCTTTGAACTCGAGTTCAAAGGTCACACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-785s21c1
Sequence:CCGGACTCTGGAGCAAAGCGTTATGCTCGAGCATAACGCTTTGCTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017652.2-1594s21c1
Sequence:CCGGTCATTGGTTACCACAATATTTCTCGAGAAATATTGTGGTAACCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017652.2-499s21c1
Sequence:CCGGGAACCCAGAAGAGATCACAAACTCGAGTTTGTGATCTCTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks