EMAIL THIS PAGE TO A FRIEND

ZNF587

zinc finger protein 587

Synonyms: ZF6
Species: Human ZNF587(84914)
UniProtKB ID: Q96SQ5, A0AV72, G3V0H5, Q6ZMK8
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0096 AQUA Peptide ISVQ[R] Bordetella pertussis Tohama I, Pseudoalteromonas atlantica T6c, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360420 predicted 1893
2 SASI_Hs01_00082274 predicted 646
3 SASI_Hs01_00082275 predicted 1440
4 SASI_Hs01_00082276 predicted 1477
5 SASI_Hs01_00082277 predicted 837
6 SASI_Hs01_00082278 predicted 1071
7 SASI_Hs01_00082279 predicted 691
8 SASI_Hs01_00082280 predicted 591
9 SASI_Hs01_00082281 predicted 1477
10 SASI_Hs01_00082282 predicted 602
11 SASI_Hs01_00082283 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032828
ZNF587 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 587
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2125s21c1
Sequence:CCGGGCTGGGATTATGAGTACACACCTCGAGGTGTGTACTCATAATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2302s21c1
Sequence:CCGGTTTCGTATTGCTTAGAATATGCTCGAGCATATTCTAAGCAATACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-1895s21c1
Sequence:CCGGGAAGCATCCCGTCTCGTTAAACTCGAGTTTAACGAGACGGGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032828.1-2399s1c1
Sequence:CCGGGCCTCCCAAGTTCAACTGATTCTCGAGAATCAGTTGAACTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1560s1c1
Sequence:CCGGCAATAAGCACAGCGTGACTATCTCGAGATAGTCACGCTGTGCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-465s1c1
Sequence:CCGGCCACCAGGAAACTCATCACAACTCGAGTTGTGATGAGTTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1367s1c1
Sequence:CCGGGCAAGGAATGTGGGAAATCATCTCGAGATGATTTCCCACATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-258s1c1
Sequence:CCGGCCGTGATGTGATGCTAGAGAACTCGAGTTCTCTAGCATCACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032828
ZNF587 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 587
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2125s21c1
Sequence:CCGGGCTGGGATTATGAGTACACACCTCGAGGTGTGTACTCATAATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2302s21c1
Sequence:CCGGTTTCGTATTGCTTAGAATATGCTCGAGCATATTCTAAGCAATACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-1895s21c1
Sequence:CCGGGAAGCATCCCGTCTCGTTAAACTCGAGTTTAACGAGACGGGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032828.1-2399s1c1
Sequence:CCGGGCCTCCCAAGTTCAACTGATTCTCGAGAATCAGTTGAACTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1560s1c1
Sequence:CCGGCAATAAGCACAGCGTGACTATCTCGAGATAGTCACGCTGTGCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-465s1c1
Sequence:CCGGCCACCAGGAAACTCATCACAACTCGAGTTGTGATGAGTTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1367s1c1
Sequence:CCGGGCAAGGAATGTGGGAAATCATCTCGAGATGATTTCCCACATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-258s1c1
Sequence:CCGGCCGTGATGTGATGCTAGAGAACTCGAGTTCTCTAGCATCACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032828
ZNF587 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 587
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2125s21c1
Sequence:CCGGGCTGGGATTATGAGTACACACCTCGAGGTGTGTACTCATAATCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-2302s21c1
Sequence:CCGGTTTCGTATTGCTTAGAATATGCTCGAGCATATTCTAAGCAATACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032828.2-1895s21c1
Sequence:CCGGGAAGCATCCCGTCTCGTTAAACTCGAGTTTAACGAGACGGGATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032828.1-2399s1c1
Sequence:CCGGGCCTCCCAAGTTCAACTGATTCTCGAGAATCAGTTGAACTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1560s1c1
Sequence:CCGGCAATAAGCACAGCGTGACTATCTCGAGATAGTCACGCTGTGCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-465s1c1
Sequence:CCGGCCACCAGGAAACTCATCACAACTCGAGTTGTGATGAGTTTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-1367s1c1
Sequence:CCGGGCAAGGAATGTGGGAAATCATCTCGAGATGATTTCCCACATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032828.1-258s1c1
Sequence:CCGGCCGTGATGTGATGCTAGAGAACTCGAGTTCTCTAGCATCACATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks