EMAIL THIS PAGE TO A FRIEND

ZNF589

zinc finger protein 589

Synonyms: SZF1
Species: Human ZNF589(51385), domestic cat ZNF589(101098697)
UniProtKB ID: Q86UQ0, Q86UC9, Q9BRI6, Q9BRY3, Q9Y611, Q9Y612
Gene ID:
domestic cat(101098697) zinc finger protein 589
239 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016089 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016089 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056276 predicted 1049
2 SASI_Hs02_00348844 predicted 442
3 SASI_Hs02_00348845 predicted 996
4 SASI_Hs01_00056278 predicted 998
5 SASI_Hs02_00348846 predicted 965
6 SASI_Hs01_00056279 predicted 644
7 SASI_Hs01_00056280 predicted 351
8 SASI_Hs01_00056281 predicted 612
9 SASI_Hs02_00348847 predicted 443
10 SASI_Hs02_00348848 predicted 1166
11 SASI_Hs01_00056274 predicted 1461
12 SASI_Hs01_00056275 predicted 1662
13 SASI_Hs01_00056277 predicted 1357
14 SASI_Hs01_00056282 predicted 1448
15 SASI_Hs01_00056283 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016089
ZNF589 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 589
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-691s1c1
Sequence:CCGGCCAGGTTTCCATGCAGGAAATCTCGAGATTTCCTGCATGGAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-410s1c1
Sequence:CCGGGCAGAACTATAATAAACCCAACTCGAGTTGGGTTTATTATAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1506s1c1
Sequence:CCGGCATGACACTCTCCTGCTTTATCTCGAGATAAAGCAGGAGAGTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1216s1c1
Sequence:CCGGCGAGGCTTTATAGTTGAGTCACTCGAGTGACTCAACTATAAAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-956s1c1
Sequence:CCGGGCTCTGAGGAAGTAGACAGAACTCGAGTTCTGTCTACTTCCTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-226s21c1
Sequence:CCGGCTTGAGCAGAGGAACCTATACCTCGAGGTATAGGTTCCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-450s21c1
Sequence:GTACCGGGTCACAACATCCTTCTGATAACTCGAGTTATCAGAAGGATGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-576s21c1
Sequence:CCGGGTTCCAGAGACCACCAATAAGCTCGAGCTTATTGGTGGTCTCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-1045s21c1
Sequence:CCGGACAAGGGAGAAATCGTTTATGCTCGAGCATAAACGATTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016089.2-2826s21c1
Sequence:CCGGCCATGCTCGGGTGGCTAAATTCTCGAGAATTTAGCCACCCGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016089
ZNF589 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 589
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-691s1c1
Sequence:CCGGCCAGGTTTCCATGCAGGAAATCTCGAGATTTCCTGCATGGAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-410s1c1
Sequence:CCGGGCAGAACTATAATAAACCCAACTCGAGTTGGGTTTATTATAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1506s1c1
Sequence:CCGGCATGACACTCTCCTGCTTTATCTCGAGATAAAGCAGGAGAGTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1216s1c1
Sequence:CCGGCGAGGCTTTATAGTTGAGTCACTCGAGTGACTCAACTATAAAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-956s1c1
Sequence:CCGGGCTCTGAGGAAGTAGACAGAACTCGAGTTCTGTCTACTTCCTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-226s21c1
Sequence:CCGGCTTGAGCAGAGGAACCTATACCTCGAGGTATAGGTTCCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-450s21c1
Sequence:GTACCGGGTCACAACATCCTTCTGATAACTCGAGTTATCAGAAGGATGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-576s21c1
Sequence:CCGGGTTCCAGAGACCACCAATAAGCTCGAGCTTATTGGTGGTCTCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-1045s21c1
Sequence:CCGGACAAGGGAGAAATCGTTTATGCTCGAGCATAAACGATTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016089.2-2826s21c1
Sequence:CCGGCCATGCTCGGGTGGCTAAATTCTCGAGAATTTAGCCACCCGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016089
ZNF589 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 589
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-691s1c1
Sequence:CCGGCCAGGTTTCCATGCAGGAAATCTCGAGATTTCCTGCATGGAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-410s1c1
Sequence:CCGGGCAGAACTATAATAAACCCAACTCGAGTTGGGTTTATTATAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1506s1c1
Sequence:CCGGCATGACACTCTCCTGCTTTATCTCGAGATAAAGCAGGAGAGTGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-1216s1c1
Sequence:CCGGCGAGGCTTTATAGTTGAGTCACTCGAGTGACTCAACTATAAAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016089.1-956s1c1
Sequence:CCGGGCTCTGAGGAAGTAGACAGAACTCGAGTTCTGTCTACTTCCTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-226s21c1
Sequence:CCGGCTTGAGCAGAGGAACCTATACCTCGAGGTATAGGTTCCTCTGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-450s21c1
Sequence:GTACCGGGTCACAACATCCTTCTGATAACTCGAGTTATCAGAAGGATGTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-576s21c1
Sequence:CCGGGTTCCAGAGACCACCAATAAGCTCGAGCTTATTGGTGGTCTCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016089.2-1045s21c1
Sequence:CCGGACAAGGGAGAAATCGTTTATGCTCGAGCATAAACGATTTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016089.2-2826s21c1
Sequence:CCGGCCATGCTCGGGTGGCTAAATTCTCGAGAATTTAGCCACCCGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks