EMAIL THIS PAGE TO A FRIEND

ZNF592

zinc finger protein 592

Synonyms: CAMOS SCAR5
UniProtKB ID: Q92610, Q2M1T2, Q504Y9
Gene ID:
Human(9640) Summary: This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Zebrafish(571276) zinc finger protein 592
chicken(415335) zinc finger protein 592
domestic cat(101099300) zinc finger protein 592
Horse(100053191) zinc finger protein 592
dog(488751) zinc finger protein 592
Domestic Rabbit(100337771) zinc finger protein 592
naked mole-rat(101723722) zinc finger protein 592
domestic guinea pig(100731770) zinc finger protein 592
cow(516451) zinc finger protein 592
sheep(101109304) zinc finger protein 592
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014630 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014630 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012052 predicted 3045
2 SASI_Hs01_00012053 predicted 3530
3 SASI_Hs02_00345928 predicted 799
4 SASI_Hs01_00012054 predicted 1978
5 SASI_Hs02_00345929 predicted 3097
6 SASI_Hs02_00345930 predicted 1166
7 SASI_Hs01_00012056 predicted 2457
8 SASI_Hs01_00012057 predicted 560
9 SASI_Hs01_00012058 predicted 751
10 SASI_Hs01_00012059 predicted 1145
11 SASI_Hs01_00012051 predicted 3163
12 SASI_Hs01_00012055 predicted 3338
13 SASI_Hs01_00012060 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014630
ZNF592 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 592
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014630.1-4571s1c1
Sequence:CCGGGCTCTGAATTTGCTTCTGTTACTCGAGTAACAGAAGCAAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1024s1c1
Sequence:CCGGCCCATCAAAGATAACGGATTTCTCGAGAAATCCGTTATCTTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1055s1c1
Sequence:CCGGCCAAACACTCTGACAGTTATTCTCGAGAATAACTGTCAGAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-3767s1c1
Sequence:CCGGGCCTTATGCATGGCATCAGAACTCGAGTTCTGATGCCATGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014630.1-4905s1c1
Sequence:CCGGCCCTGTCTTCTCTGATTCTTTCTCGAGAAAGAATCAGAGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014630.1-981s1c1
Sequence:CCGGCTTCAACCAGTTCAGTCCAATCTCGAGATTGGACTGAACTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-4080s1c1
Sequence:CCGGCCACCTCTTCATTGTCCACAACTCGAGTTGTGGACAATGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014630
ZNF592 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 592
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014630.1-4571s1c1
Sequence:CCGGGCTCTGAATTTGCTTCTGTTACTCGAGTAACAGAAGCAAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1024s1c1
Sequence:CCGGCCCATCAAAGATAACGGATTTCTCGAGAAATCCGTTATCTTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1055s1c1
Sequence:CCGGCCAAACACTCTGACAGTTATTCTCGAGAATAACTGTCAGAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-3767s1c1
Sequence:CCGGGCCTTATGCATGGCATCAGAACTCGAGTTCTGATGCCATGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014630.1-4905s1c1
Sequence:CCGGCCCTGTCTTCTCTGATTCTTTCTCGAGAAAGAATCAGAGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014630.1-981s1c1
Sequence:CCGGCTTCAACCAGTTCAGTCCAATCTCGAGATTGGACTGAACTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-4080s1c1
Sequence:CCGGCCACCTCTTCATTGTCCACAACTCGAGTTGTGGACAATGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014630
ZNF592 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 592
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014630.1-4571s1c1
Sequence:CCGGGCTCTGAATTTGCTTCTGTTACTCGAGTAACAGAAGCAAATTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1024s1c1
Sequence:CCGGCCCATCAAAGATAACGGATTTCTCGAGAAATCCGTTATCTTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-1055s1c1
Sequence:CCGGCCAAACACTCTGACAGTTATTCTCGAGAATAACTGTCAGAGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-3767s1c1
Sequence:CCGGGCCTTATGCATGGCATCAGAACTCGAGTTCTGATGCCATGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014630.1-4905s1c1
Sequence:CCGGCCCTGTCTTCTCTGATTCTTTCTCGAGAAAGAATCAGAGAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014630.1-981s1c1
Sequence:CCGGCTTCAACCAGTTCAGTCCAATCTCGAGATTGGACTGAACTGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014630.1-4080s1c1
Sequence:CCGGCCACCTCTTCATTGTCCACAACTCGAGTTGTGGACAATGAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks