EMAIL THIS PAGE TO A FRIEND

ZNF593

zinc finger protein 593

Synonyms: ZT86
UniProtKB ID: O00488, B2R4S0, Q5T2H7
Gene ID:
cow(508477) zinc finger protein 593
sheep(101112632) zinc finger protein 593
domestic guinea pig(100730924) zinc finger protein 593
naked mole-rat(101708207) zinc finger protein 593
Zebrafish(559352) zinc finger protein 593
dog(487360) zinc finger protein 593
domestic cat(101084467) zinc finger protein 593
chicken(419549) zinc finger protein 593
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015871 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013951 MISSION® esiRNA esiRNA targeting human ZNF593 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015871 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223092 predicted 282
2 SASI_Hs01_00223093 predicted 286
3 SASI_Hs01_00223085 predicted 397
4 SASI_Hs02_00348450 predicted 431
5 SASI_Hs02_00348451 predicted 262
6 SASI_Hs02_00348452 predicted 356
7 SASI_Hs01_00223087 predicted 313
8 SASI_Hs01_00223088 predicted 314
9 SASI_Hs02_00348453 predicted 271
10 SASI_Hs02_00348454 predicted 358
11 SASI_Hs01_00223086 predicted 349
12 SASI_Hs01_00223089 predicted 366
13 SASI_Hs01_00223090 predicted 366
14 SASI_Hs01_00223091 predicted 341
15 SASI_Hs01_00223094 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015871
VALIDATED
ZNF593 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 593
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-261s1c1
Sequence:CCGGGAGGTACTTCATCGATTCCACCTCGAGGTGGAATCGATGAAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-260s1c1
Sequence:CCGGCGAGGTACTTCATCGATTCCACTCGAGTGGAATCGATGAAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-264s1c1
Sequence:CCGGGTACTTCATCGATTCCACCAACTCGAGTTGGTGGAATCGATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-462s21c1
Sequence:CCGGTGAGGTCCCTGAGATGGATACCTCGAGGTATCCATCTCAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-299s21c1
Sequence:CCGGTCGATTCCACCAACCTGAAGACTCGAGTCTTCAGGTTGGTGGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-367s21c1
Sequence:CCGGGTCGAGCCCTACAGTCAGGAACTCGAGTTCCTGACTGTAGGGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-328s1c1
Sequence:CCGGCGATCCAAAGACCACAAGAAACTCGAGTTTCTTGTGGTCTTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-475s1c1
Sequence:CCGGATGGATACCTCTACCTGACATCTCGAGATGTCAGGTAGAGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-400s21c1
Sequence:CCGGGCAGCGGGTATGGGATCCTATCTCGAGATAGGATCCCATACCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-315s21c1
Sequence:CCGGGAAGACCCACTTCCGATCCAACTCGAGTTGGATCGGAAGTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015871
VALIDATED
ZNF593 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 593
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-261s1c1
Sequence:CCGGGAGGTACTTCATCGATTCCACCTCGAGGTGGAATCGATGAAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-260s1c1
Sequence:CCGGCGAGGTACTTCATCGATTCCACTCGAGTGGAATCGATGAAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-264s1c1
Sequence:CCGGGTACTTCATCGATTCCACCAACTCGAGTTGGTGGAATCGATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-462s21c1
Sequence:CCGGTGAGGTCCCTGAGATGGATACCTCGAGGTATCCATCTCAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-299s21c1
Sequence:CCGGTCGATTCCACCAACCTGAAGACTCGAGTCTTCAGGTTGGTGGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-367s21c1
Sequence:CCGGGTCGAGCCCTACAGTCAGGAACTCGAGTTCCTGACTGTAGGGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-328s1c1
Sequence:CCGGCGATCCAAAGACCACAAGAAACTCGAGTTTCTTGTGGTCTTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-475s1c1
Sequence:CCGGATGGATACCTCTACCTGACATCTCGAGATGTCAGGTAGAGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-400s21c1
Sequence:CCGGGCAGCGGGTATGGGATCCTATCTCGAGATAGGATCCCATACCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-315s21c1
Sequence:CCGGGAAGACCCACTTCCGATCCAACTCGAGTTGGATCGGAAGTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015871
VALIDATED
ZNF593 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 593
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-261s1c1
Sequence:CCGGGAGGTACTTCATCGATTCCACCTCGAGGTGGAATCGATGAAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-260s1c1
Sequence:CCGGCGAGGTACTTCATCGATTCCACTCGAGTGGAATCGATGAAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.2-264s1c1
Sequence:CCGGGTACTTCATCGATTCCACCAACTCGAGTTGGTGGAATCGATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-462s21c1
Sequence:CCGGTGAGGTCCCTGAGATGGATACCTCGAGGTATCCATCTCAGGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-299s21c1
Sequence:CCGGTCGATTCCACCAACCTGAAGACTCGAGTCTTCAGGTTGGTGGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-367s21c1
Sequence:CCGGGTCGAGCCCTACAGTCAGGAACTCGAGTTCCTGACTGTAGGGCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-328s1c1
Sequence:CCGGCGATCCAAAGACCACAAGAAACTCGAGTTTCTTGTGGTCTTTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015871.4-475s1c1
Sequence:CCGGATGGATACCTCTACCTGACATCTCGAGATGTCAGGTAGAGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015871.4-400s21c1
Sequence:CCGGGCAGCGGGTATGGGATCCTATCTCGAGATAGGATCCCATACCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015871.4-315s21c1
Sequence:CCGGGAAGACCCACTTCCGATCCAACTCGAGTTGGATCGGAAGTGGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks