EMAIL THIS PAGE TO A FRIEND

ZNF594

zinc finger protein 594

UniProtKB ID: Q96JF6, Q6RFS0
Gene ID:
dog(484250) zinc finger protein 594
Horse(100072818) zinc finger protein 594
cow(101906265) zinc finger protein 594
sheep(101114793) zinc finger protein 594
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067178 Anti-ZNF594 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032530 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101951 MISSION® esiRNA esiRNA human ZNF594 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032530 Rosetta Predictions human pricing
XM_290737 Rosetta Predictions human pricing
XM_932723 Rosetta Predictions human pricing
XM_932728 Rosetta Predictions human pricing
XM_932737 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360028 predicted 975
2 SASI_Hs02_00360029 predicted 566
3 SASI_Hs02_00360030 predicted 279
4 SASI_Hs02_00360031 predicted 1275
5 SASI_Hs02_00360032 predicted 1765
6 SASI_Hs02_00360033 predicted 2384
7 SASI_Hs02_00360034 predicted 242
8 SASI_Hs02_00360035 predicted 898
9 SASI_Hs02_00360036 predicted 1321
10 SASI_Hs02_00360037 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271178 predicted 952
2 SASI_Hs01_00271179 predicted 414
3 SASI_Hs01_00271180 predicted 551
4 SASI_Hs01_00271181 predicted 264
5 SASI_Hs01_00271182 predicted 1261
6 SASI_Hs01_00271183 predicted 2367
7 SASI_Hs01_00271184 predicted 221
8 SASI_Hs01_00271185 predicted 883
9 SASI_Hs01_00271186 predicted 1302
10 SASI_Hs01_00271187 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271354 predicted 968
2 SASI_Hs01_00271355 predicted 429
3 SASI_Hs01_00271356 predicted 563
4 SASI_Hs01_00271357 predicted 269
5 SASI_Hs01_00271358 predicted 1264
6 SASI_Hs01_00271359 predicted 235
7 SASI_Hs01_00271360 predicted 886
8 SASI_Hs01_00271361 predicted 1318
9 SASI_Hs01_00271362 predicted 727
10 SASI_Hs01_00271363 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280550 predicted 1229
2 SASI_Hs01_00280551 predicted 694
3 SASI_Hs01_00280552 predicted 830
4 SASI_Hs01_00280553 predicted 532
5 SASI_Hs01_00280554 predicted 1532
6 SASI_Hs01_00280555 predicted 496
7 SASI_Hs01_00280556 predicted 1158
8 SASI_Hs01_00280557 predicted 1579
9 SASI_Hs01_00280558 predicted 994
10 SASI_Hs01_00280559 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269208 predicted 2172
2 SASI_Hs01_00269209 predicted 2181
3 SASI_Hs01_00269210 predicted 2339
4 SASI_Hs01_00269211 predicted 1933
5 SASI_Hs01_00269212 predicted 2572
6 SASI_Hs01_00269213 predicted 1976
7 SASI_Hs01_00269214 predicted 1982
8 SASI_Hs01_00269215 predicted 2603
9 SASI_Hs01_00269216 predicted 1985
10 SASI_Hs01_00269217 predicted 2176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032530
ZNF594 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 594
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-1849s21c1
Sequence:CCGGGCGAAAGCTTATTGGTGTAATCTCGAGATTACACCAATAAGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032530.1-3696s21c1
Sequence:CCGGTATGGTCCCAACGATACAATTCTCGAGAATTGTATCGTTGGGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-270s21c1
Sequence:CCGGTAATTCTGAGGACAGATTATTCTCGAGAATAATCTGTCCTCAGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-439s21c1
Sequence:CCGGGGAGAAAGCTCCCATAGATATCTCGAGATATCTATGGGAGCTTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-350s21c1
Sequence:CCGGGTATCAGGGAAATGCATATTACTCGAGTAATATGCATTTCCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032530
ZNF594 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 594
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-1849s21c1
Sequence:CCGGGCGAAAGCTTATTGGTGTAATCTCGAGATTACACCAATAAGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032530.1-3696s21c1
Sequence:CCGGTATGGTCCCAACGATACAATTCTCGAGAATTGTATCGTTGGGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-270s21c1
Sequence:CCGGTAATTCTGAGGACAGATTATTCTCGAGAATAATCTGTCCTCAGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-439s21c1
Sequence:CCGGGGAGAAAGCTCCCATAGATATCTCGAGATATCTATGGGAGCTTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-350s21c1
Sequence:CCGGGTATCAGGGAAATGCATATTACTCGAGTAATATGCATTTCCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032530
ZNF594 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 594
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-1849s21c1
Sequence:CCGGGCGAAAGCTTATTGGTGTAATCTCGAGATTACACCAATAAGCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032530.1-3696s21c1
Sequence:CCGGTATGGTCCCAACGATACAATTCTCGAGAATTGTATCGTTGGGACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-270s21c1
Sequence:CCGGTAATTCTGAGGACAGATTATTCTCGAGAATAATCTGTCCTCAGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-439s21c1
Sequence:CCGGGGAGAAAGCTCCCATAGATATCTCGAGATATCTATGGGAGCTTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032530.1-350s21c1
Sequence:CCGGGTATCAGGGAAATGCATATTACTCGAGTAATATGCATTTCCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks