EMAIL THIS PAGE TO A FRIEND

ZNF595

zinc finger protein 595

Species: Human ZNF595(152687)
UniProtKB ID: Q8IYB9
Gene ID:
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301384 ANTI-ZNF595 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105081 MISSION® esiRNA esiRNA human ZNF595 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182524 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102355 predicted 941
2 SASI_Hs02_00370614 predicted 584
3 SASI_Hs01_00102356 predicted 1613
4 SASI_Hs01_00102357 predicted 536
5 SASI_Hs01_00102359 predicted 1459
6 SASI_Hs02_00370615 predicted 673
7 SASI_Hs02_00370616 predicted 594
8 SASI_Hs01_00102363 predicted 526
9 SASI_Hs01_00102364 predicted 1867
10 SASI_Hs01_00102360 predicted 371
11 SASI_Hs01_00102358 predicted 1639
12 SASI_Hs01_00102361 predicted 878
13 SASI_Hs01_00102362 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182524
ZNF595 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 595
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2236s21c1
Sequence:CCGGGTATCTATTCATGGCTTATTTCTCGAGAAATAAGCCATGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2339s21c1
Sequence:CCGGATTACACACAGTCCAGTTATACTCGAGTATAACTGGACTGTGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2158s21c1
Sequence:CCGGAGAATATTGCTCCCATATAAACTCGAGTTTATATGGGAGCAATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-791s1c1
Sequence:CCGGCCACATCACTTAGTAAACATACTCGAGTATGTTTACTAAGTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1458s1c1
Sequence:CCGGCCAATCCTCAACTCTTATATTCTCGAGAATATAAGAGTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1547s1c1
Sequence:CCGGCCACAACACTGAACGAACATACTCGAGTATGTTCGTTCAGTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-378s1c1
Sequence:CCGGCCCAGCTATATGTTCTCCTTTCTCGAGAAAGGAGAACATATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1206s1c1
Sequence:CCGGCCAATCCTCAAGTCTTATTATCTCGAGATAATAAGACTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182524
ZNF595 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 595
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2236s21c1
Sequence:CCGGGTATCTATTCATGGCTTATTTCTCGAGAAATAAGCCATGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2339s21c1
Sequence:CCGGATTACACACAGTCCAGTTATACTCGAGTATAACTGGACTGTGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2158s21c1
Sequence:CCGGAGAATATTGCTCCCATATAAACTCGAGTTTATATGGGAGCAATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-791s1c1
Sequence:CCGGCCACATCACTTAGTAAACATACTCGAGTATGTTTACTAAGTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1458s1c1
Sequence:CCGGCCAATCCTCAACTCTTATATTCTCGAGAATATAAGAGTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1547s1c1
Sequence:CCGGCCACAACACTGAACGAACATACTCGAGTATGTTCGTTCAGTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-378s1c1
Sequence:CCGGCCCAGCTATATGTTCTCCTTTCTCGAGAAAGGAGAACATATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1206s1c1
Sequence:CCGGCCAATCCTCAAGTCTTATTATCTCGAGATAATAAGACTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182524
ZNF595 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 595
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2236s21c1
Sequence:CCGGGTATCTATTCATGGCTTATTTCTCGAGAAATAAGCCATGAATAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2339s21c1
Sequence:CCGGATTACACACAGTCCAGTTATACTCGAGTATAACTGGACTGTGTGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182524.2-2158s21c1
Sequence:CCGGAGAATATTGCTCCCATATAAACTCGAGTTTATATGGGAGCAATATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-791s1c1
Sequence:CCGGCCACATCACTTAGTAAACATACTCGAGTATGTTTACTAAGTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1458s1c1
Sequence:CCGGCCAATCCTCAACTCTTATATTCTCGAGAATATAAGAGTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1547s1c1
Sequence:CCGGCCACAACACTGAACGAACATACTCGAGTATGTTCGTTCAGTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-378s1c1
Sequence:CCGGCCCAGCTATATGTTCTCCTTTCTCGAGAAAGGAGAACATATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182524.1-1206s1c1
Sequence:CCGGCCAATCCTCAAGTCTTATTATCTCGAGATAATAAGACTTGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks