EMAIL THIS PAGE TO A FRIEND

ZNF596

zinc finger protein 596

UniProtKB ID: Q8TC21, B2R8P4, O95015, Q8N9X0
Gene ID:
dog(486142) zinc finger protein 596
Horse(100062614) zinc finger protein 596
cow(511959) zinc finger protein 596
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042415 Rosetta Predictions human pricing
NM_001042416 Rosetta Predictions human pricing
NM_173539 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309628 predicted 1264
2 SASI_Hs02_00309629 predicted 1682
3 SASI_Hs02_00309630 predicted 1806
4 SASI_Hs02_00309631 predicted 657
5 SASI_Hs02_00309632 predicted 1726
6 SASI_Hs02_00309633 predicted 1094
7 SASI_Hs02_00309634 predicted 692
8 SASI_Hs02_00309635 predicted 1174
9 SASI_Hs02_00309636 predicted 607
10 SASI_Hs02_00309637 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309638 predicted 1338
2 SASI_Hs02_00309639 predicted 1751
3 SASI_Hs02_00309640 predicted 1880
4 SASI_Hs02_00309641 predicted 723
5 SASI_Hs02_00309642 predicted 1794
6 SASI_Hs02_00309643 predicted 1161
7 SASI_Hs02_00309644 predicted 767
8 SASI_Hs02_00309645 predicted 1240
9 SASI_Hs02_00309646 predicted 680
10 SASI_Hs02_00309647 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368336 predicted 1242
2 SASI_Hs01_00112754 predicted 1658
3 SASI_Hs01_00112756 predicted 1785
4 SASI_Hs01_00112757 predicted 637
5 SASI_Hs01_00112758 predicted 1703
6 SASI_Hs01_00112759 predicted 1072
7 SASI_Hs01_00112760 predicted 673
8 SASI_Hs01_00112761 predicted 1142
9 SASI_Hs01_00112762 predicted 583
10 SASI_Hs01_00112763 predicted 1710
11 SASI_Hs01_00112755 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173539
ZNF596 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 596
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173539.1-2293s1c1
Sequence:CCGGCCTTAGTCAATACCAGTATTTCTCGAGAAATACTGGTATTGACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-445s1c1
Sequence:CCGGCTATGCAATGACTTAGGAGAACTCGAGTTCTCCTAAGTCATTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-260s1c1
Sequence:CCGGTCTGCAAATCAGTTGTGCTTTCTCGAGAAAGCACAACTGATTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-259s1c1
Sequence:CCGGCTCTGCAAATCAGTTGTGCTTCTCGAGAAGCACAACTGATTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-1227s1c1
Sequence:CCGGCACTGAATCTTCTGTGCTTAACTCGAGTTAAGCACAGAAGATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1806s21c1
Sequence:CCGGATCATCAGCTGTAGCGTTAACCTCGAGGTTAACGCTACAGCTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1979s21c1
Sequence:CCGGGACTCTAGGCTGACCATATACCTCGAGGTATATGGTCAGCCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173539.2-1085s21c1
Sequence:CCGGTTAGACGACATGAGATGATTCCTCGAGGAATCATCTCATGTCGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173539
ZNF596 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 596
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173539.1-2293s1c1
Sequence:CCGGCCTTAGTCAATACCAGTATTTCTCGAGAAATACTGGTATTGACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-445s1c1
Sequence:CCGGCTATGCAATGACTTAGGAGAACTCGAGTTCTCCTAAGTCATTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-260s1c1
Sequence:CCGGTCTGCAAATCAGTTGTGCTTTCTCGAGAAAGCACAACTGATTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-259s1c1
Sequence:CCGGCTCTGCAAATCAGTTGTGCTTCTCGAGAAGCACAACTGATTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-1227s1c1
Sequence:CCGGCACTGAATCTTCTGTGCTTAACTCGAGTTAAGCACAGAAGATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1806s21c1
Sequence:CCGGATCATCAGCTGTAGCGTTAACCTCGAGGTTAACGCTACAGCTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1979s21c1
Sequence:CCGGGACTCTAGGCTGACCATATACCTCGAGGTATATGGTCAGCCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173539.2-1085s21c1
Sequence:CCGGTTAGACGACATGAGATGATTCCTCGAGGAATCATCTCATGTCGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173539
ZNF596 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 596
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173539.1-2293s1c1
Sequence:CCGGCCTTAGTCAATACCAGTATTTCTCGAGAAATACTGGTATTGACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-445s1c1
Sequence:CCGGCTATGCAATGACTTAGGAGAACTCGAGTTCTCCTAAGTCATTGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-260s1c1
Sequence:CCGGTCTGCAAATCAGTTGTGCTTTCTCGAGAAAGCACAACTGATTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-259s1c1
Sequence:CCGGCTCTGCAAATCAGTTGTGCTTCTCGAGAAGCACAACTGATTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173539.1-1227s1c1
Sequence:CCGGCACTGAATCTTCTGTGCTTAACTCGAGTTAAGCACAGAAGATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1806s21c1
Sequence:CCGGATCATCAGCTGTAGCGTTAACCTCGAGGTTAACGCTACAGCTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173539.2-1979s21c1
Sequence:CCGGGACTCTAGGCTGACCATATACCTCGAGGTATATGGTCAGCCTAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173539.2-1085s21c1
Sequence:CCGGTTAGACGACATGAGATGATTCCTCGAGGAATCATCTCATGTCGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks