EMAIL THIS PAGE TO A FRIEND

ZNF597

zinc finger protein 597

UniProtKB ID: Q96LX8
Gene ID:
cow(100140355) zinc finger protein 597
sheep(101122568) zinc finger protein 597
naked mole-rat(101706593) zinc finger protein 597
domestic guinea pig(100717878) zinc finger protein 597
domestic cat(101095462) zinc finger protein 597
dog(100683002) zinc finger protein 597
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056741 MISSION® esiRNA esiRNA human ZNF597 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152457 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236631 predicted 588
2 SASI_Hs01_00236632 predicted 310
3 SASI_Hs01_00236633 predicted 1244
4 SASI_Hs01_00236634 predicted 1220
5 SASI_Hs01_00236635 predicted 677
6 SASI_Hs01_00236636 predicted 1078
7 SASI_Hs01_00236637 predicted 366
8 SASI_Hs01_00236638 predicted 866
9 SASI_Hs01_00236639 predicted 902
10 SASI_Hs01_00236640 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152457
ZNF597 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 597
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1505s21c1
Sequence:CCGGTGTATGGTGGGAAGCAGTTACCTCGAGGTAACTGCTTCCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152457.1-1251s21c1
Sequence:CCGGTTATTTCCCATCAGAACATTCCTCGAGGAATGTTCTGATGGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1598s21c1
Sequence:CCGGTTGATTTAGGCAGTATCATTTCTCGAGAAATGATACTGCCTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-869s1c1
Sequence:CCGGCGACACATGAATAGCCACGTACTCGAGTACGTGGCTATTCATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-359s1c1
Sequence:CCGGCCTGAGATTAATCAGCAGTTACTCGAGTAACTGCTGATTAATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-988s1c1
Sequence:CCGGCGAATCTACTAACTGTGATAACTCGAGTTATCACAGTTAGTAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-594s1c1
Sequence:CCGGGAACCAACACACTTTCTGAAACTCGAGTTTCAGAAAGTGTGTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-1072s1c1
Sequence:CCGGCCAGCACACTAAGTGCATGAACTCGAGTTCATGCACTTAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152457
ZNF597 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 597
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1505s21c1
Sequence:CCGGTGTATGGTGGGAAGCAGTTACCTCGAGGTAACTGCTTCCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152457.1-1251s21c1
Sequence:CCGGTTATTTCCCATCAGAACATTCCTCGAGGAATGTTCTGATGGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1598s21c1
Sequence:CCGGTTGATTTAGGCAGTATCATTTCTCGAGAAATGATACTGCCTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-869s1c1
Sequence:CCGGCGACACATGAATAGCCACGTACTCGAGTACGTGGCTATTCATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-359s1c1
Sequence:CCGGCCTGAGATTAATCAGCAGTTACTCGAGTAACTGCTGATTAATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-988s1c1
Sequence:CCGGCGAATCTACTAACTGTGATAACTCGAGTTATCACAGTTAGTAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-594s1c1
Sequence:CCGGGAACCAACACACTTTCTGAAACTCGAGTTTCAGAAAGTGTGTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-1072s1c1
Sequence:CCGGCCAGCACACTAAGTGCATGAACTCGAGTTCATGCACTTAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152457
ZNF597 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 597
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1505s21c1
Sequence:CCGGTGTATGGTGGGAAGCAGTTACCTCGAGGTAACTGCTTCCCACCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152457.1-1251s21c1
Sequence:CCGGTTATTTCCCATCAGAACATTCCTCGAGGAATGTTCTGATGGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152457.1-1598s21c1
Sequence:CCGGTTGATTTAGGCAGTATCATTTCTCGAGAAATGATACTGCCTAAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-869s1c1
Sequence:CCGGCGACACATGAATAGCCACGTACTCGAGTACGTGGCTATTCATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-359s1c1
Sequence:CCGGCCTGAGATTAATCAGCAGTTACTCGAGTAACTGCTGATTAATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-988s1c1
Sequence:CCGGCGAATCTACTAACTGTGATAACTCGAGTTATCACAGTTAGTAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-594s1c1
Sequence:CCGGGAACCAACACACTTTCTGAAACTCGAGTTTCAGAAAGTGTGTTGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152457.1-1072s1c1
Sequence:CCGGCCAGCACACTAAGTGCATGAACTCGAGTTCATGCACTTAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks