EMAIL THIS PAGE TO A FRIEND

ZNF598

zinc finger protein 598

UniProtKB ID: Q86UK7, Q8IW49, Q8N3D9, Q96FG3, Q9H7J3
Gene ID:
Human(90850) Summary: Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Zebrafish(407728) zinc finger protein 598
Horse(100068083) zinc finger protein 598
domestic cat(101083476) zinc finger protein 598
dog(490061) zinc finger protein 598
chicken(416549) zinc finger protein 598
domestic guinea pig(100730683) zinc finger protein 598
naked mole-rat(101721973) zinc finger protein 598
cow(505086) zinc finger protein 598
sheep(101113383) zinc finger protein 598
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178167 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116131 MISSION® esiRNA esiRNA human ZNF598 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178167 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077398 predicted 1758
2 SASI_Hs01_00077400 predicted 482
3 SASI_Hs01_00077401 predicted 1894
4 SASI_Hs01_00077402 predicted 670
5 SASI_Hs01_00077403 predicted 850
6 SASI_Hs01_00077404 predicted 1753
7 SASI_Hs01_00077405 predicted 440
8 SASI_Hs01_00077406 predicted 316
9 SASI_Hs01_00077407 predicted 1325
10 SASI_Hs02_00369578 predicted 1538
11 SASI_Hs01_00077399 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178167
ZNF598 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 598
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178167.2-2934s1c1
Sequence:CCGGCGGTTTGCATTCTTGTGCTTTCTCGAGAAAGCACAAGAATGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-2390s1c1
Sequence:CCGGCAGCCCAGTATTACAAGAGTTCTCGAGAACTCTTGTAATACTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-679s1c1
Sequence:CCGGCAGGACTACTACAGCGACTATCTCGAGATAGTCGCTGTAGTAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1229s1c1
Sequence:CCGGCCTCGACAAATGGTCCTGTAACTCGAGTTACAGGACCATTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-607s21c1
Sequence:CCGGGACAATGATGAGCTGCTTAAGCTCGAGCTTAAGCAGCTCATCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-325s21c1
Sequence:CCGGGATGGAAAGGTGTACGCATTGCTCGAGCAATGCGTACACCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1761s1c2
Sequence:CCGGCCAACCCTCTAAAGTTGGGAACTCGAGTTCCCAACTTTAGAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178167
ZNF598 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 598
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178167.2-2934s1c1
Sequence:CCGGCGGTTTGCATTCTTGTGCTTTCTCGAGAAAGCACAAGAATGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-2390s1c1
Sequence:CCGGCAGCCCAGTATTACAAGAGTTCTCGAGAACTCTTGTAATACTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-679s1c1
Sequence:CCGGCAGGACTACTACAGCGACTATCTCGAGATAGTCGCTGTAGTAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1229s1c1
Sequence:CCGGCCTCGACAAATGGTCCTGTAACTCGAGTTACAGGACCATTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-607s21c1
Sequence:CCGGGACAATGATGAGCTGCTTAAGCTCGAGCTTAAGCAGCTCATCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-325s21c1
Sequence:CCGGGATGGAAAGGTGTACGCATTGCTCGAGCAATGCGTACACCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1761s1c2
Sequence:CCGGCCAACCCTCTAAAGTTGGGAACTCGAGTTCCCAACTTTAGAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178167
ZNF598 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 598
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178167.2-2934s1c1
Sequence:CCGGCGGTTTGCATTCTTGTGCTTTCTCGAGAAAGCACAAGAATGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-2390s1c1
Sequence:CCGGCAGCCCAGTATTACAAGAGTTCTCGAGAACTCTTGTAATACTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-679s1c1
Sequence:CCGGCAGGACTACTACAGCGACTATCTCGAGATAGTCGCTGTAGTAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1229s1c1
Sequence:CCGGCCTCGACAAATGGTCCTGTAACTCGAGTTACAGGACCATTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-607s21c1
Sequence:CCGGGACAATGATGAGCTGCTTAAGCTCGAGCTTAAGCAGCTCATCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178167.2-325s21c1
Sequence:CCGGGATGGAAAGGTGTACGCATTGCTCGAGCAATGCGTACACCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178167.2-1761s1c2
Sequence:CCGGCCAACCCTCTAAAGTTGGGAACTCGAGTTCCCAACTTTAGAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks