EMAIL THIS PAGE TO A FRIEND

ZNF599

zinc finger protein 599

UniProtKB ID: Q96NL3, Q569K0, Q5PRG1
Gene ID:
cow(514021) zinc finger protein 599
sheep(101113951) zinc finger protein 599
Horse(100050274) zinc finger protein 599
domestic cat(101088895) zinc finger protein 599
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007248 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142721 MISSION® esiRNA esiRNA human ZNF599 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007247 Rosetta Predictions human pricing
NM_001007248 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051178 predicted 2281
2 SASI_Hs01_00051179 predicted 1070
3 SASI_Hs01_00051180 predicted 2250
4 SASI_Hs01_00051181 predicted 1301
5 SASI_Hs01_00051182 predicted 1578
6 SASI_Hs01_00051183 predicted 1140
7 SASI_Hs01_00051184 predicted 1225
8 SASI_Hs01_00051185 predicted 1514
9 SASI_Hs01_00051186 predicted 1329
10 SASI_Hs01_00051187 predicted 2286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110651 predicted 2162
2 SASI_Hs02_00305271 predicted 1601
3 SASI_Hs01_00110652 predicted 950
4 SASI_Hs01_00110653 predicted 2136
5 SASI_Hs01_00110655 predicted 1451
6 SASI_Hs01_00110656 predicted 1025
7 SASI_Hs01_00110657 predicted 1106
8 SASI_Hs01_00110658 predicted 1386
9 SASI_Hs01_00110659 predicted 1208
10 SASI_Hs02_00305272 predicted 1110
11 SASI_Hs01_00110654 predicted 1170
12 SASI_Hs01_00110660 predicted 2153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007248
VALIDATED
ZNF599 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 599
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1357s21c1
Sequence:CCGGCTCCTCATTTGCTCAACATATCTCGAGATATGTTGAGCAAATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-827s21c1
Sequence:CCGGCCTGAGAAGTTGAGTTATAAACTCGAGTTTATAACTCAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007248.2-2157s21c1
Sequence:CCGGAGATACAGGAAGGCCTATTACCTCGAGGTAATAGGCCTTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1609s21c1
Sequence:CCGGCTCCACTTTCATCCGACATAACTCGAGTTATGTCGGATGAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1084s21c1
Sequence:CCGGTGGGAAAGCCTGTCGTTATATCTCGAGATATAACGACAGGCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1511s1c1
Sequence:CCGGCTCATCCTTCACTCAGCACATCTCGAGATGTGCTGAGTGAAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007248.1-2605s1c1
Sequence:CCGGGCAGGGAATAAGACATTGAAACTCGAGTTTCAATGTCTTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1077s1c1
Sequence:CCGGGCCTGTCGTTATATGGCTGATCTCGAGATCAGCCATATAACGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1594s1c1
Sequence:CCGGGCTCCACTTTCATCCGACATACTCGAGTATGTCGGATGAAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001007248.1-543s1c1
Sequence:CCGGCTGATCTATCTACTGGAACATCTCGAGATGTTCCAGTAGATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007248
VALIDATED
ZNF599 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 599
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1357s21c1
Sequence:CCGGCTCCTCATTTGCTCAACATATCTCGAGATATGTTGAGCAAATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-827s21c1
Sequence:CCGGCCTGAGAAGTTGAGTTATAAACTCGAGTTTATAACTCAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007248.2-2157s21c1
Sequence:CCGGAGATACAGGAAGGCCTATTACCTCGAGGTAATAGGCCTTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1609s21c1
Sequence:CCGGCTCCACTTTCATCCGACATAACTCGAGTTATGTCGGATGAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1084s21c1
Sequence:CCGGTGGGAAAGCCTGTCGTTATATCTCGAGATATAACGACAGGCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1511s1c1
Sequence:CCGGCTCATCCTTCACTCAGCACATCTCGAGATGTGCTGAGTGAAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007248.1-2605s1c1
Sequence:CCGGGCAGGGAATAAGACATTGAAACTCGAGTTTCAATGTCTTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1077s1c1
Sequence:CCGGGCCTGTCGTTATATGGCTGATCTCGAGATCAGCCATATAACGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1594s1c1
Sequence:CCGGGCTCCACTTTCATCCGACATACTCGAGTATGTCGGATGAAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001007248.1-543s1c1
Sequence:CCGGCTGATCTATCTACTGGAACATCTCGAGATGTTCCAGTAGATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007248
VALIDATED
ZNF599 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 599
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1357s21c1
Sequence:CCGGCTCCTCATTTGCTCAACATATCTCGAGATATGTTGAGCAAATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-827s21c1
Sequence:CCGGCCTGAGAAGTTGAGTTATAAACTCGAGTTTATAACTCAACTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007248.2-2157s21c1
Sequence:CCGGAGATACAGGAAGGCCTATTACCTCGAGGTAATAGGCCTTCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1609s21c1
Sequence:CCGGCTCCACTTTCATCCGACATAACTCGAGTTATGTCGGATGAAAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007248.2-1084s21c1
Sequence:CCGGTGGGAAAGCCTGTCGTTATATCTCGAGATATAACGACAGGCTTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1511s1c1
Sequence:CCGGCTCATCCTTCACTCAGCACATCTCGAGATGTGCTGAGTGAAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007248.1-2605s1c1
Sequence:CCGGGCAGGGAATAAGACATTGAAACTCGAGTTTCAATGTCTTATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1077s1c1
Sequence:CCGGGCCTGTCGTTATATGGCTGATCTCGAGATCAGCCATATAACGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007248.1-1594s1c1
Sequence:CCGGGCTCCACTTTCATCCGACATACTCGAGTATGTCGGATGAAAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001007248.1-543s1c1
Sequence:CCGGCTGATCTATCTACTGGAACATCTCGAGATGTTCCAGTAGATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks