EMAIL THIS PAGE TO A FRIEND

ZNF607

zinc finger protein 607

Species: Human ZNF607(84775), naked mole-rat Znf607(101725852)
UniProtKB ID: Q96SK3, F5H141, Q6ZMN2, Q6ZMN4, Q96C40
Gene ID:
naked mole-rat(101725852) zinc finger protein 607
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360224 predicted 1156
2 SASI_Hs01_00207914 predicted 1129
3 SASI_Hs01_00207915 predicted 2475
4 SASI_Hs01_00207917 predicted 1959
5 SASI_Hs01_00207919 predicted 2319
6 SASI_Hs02_00360225 predicted 1640
7 SASI_Hs02_00360226 predicted 1381
8 SASI_Hs01_00207920 predicted 881
9 SASI_Hs01_00207921 predicted 970
10 SASI_Hs02_00360227 predicted 2714
11 SASI_Hs01_00207913 predicted 1038
12 SASI_Hs01_00207916 predicted 791
13 SASI_Hs01_00207918 predicted 1652
14 SASI_Hs01_00207922 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032689
ZNF607 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 607
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-958s1c1
Sequence:CCGGGCCTTTAGTGTATCTGGACAACTCGAGTTGTCCAGATACACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1145s1c1
Sequence:CCGGGCCTCATATATCATGACCGAACTCGAGTTCGGTCATGATATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-730s1c1
Sequence:CCGGGCCCATCATAACAGAATTCATCTCGAGATGAATTCTGTTATGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-479s1c1
Sequence:CCGGCTGCACCTCATACATTTGAAACTCGAGTTTCAAATGTATGAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1457s1c1
Sequence:CCGGGAAGGTCCTTTAGGCTTAGATCTCGAGATCTAAGCCTAAAGGACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1792s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAATTCTCGAGAATTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1372s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAAAGCTCGAGCTTTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-3105s21c1
Sequence:CCGGGATGATGGGAAAGGCTATTTACTCGAGTAAATAGCCTTTCCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-742s21c1
Sequence:CCGGCCGTATCTAAGCCAGATTTAACTCGAGTTAAATCTGGCTTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2392s21c1
Sequence:CCGGGTCATGCTTCACATCTTATTACTCGAGTAATAAGATGTGAAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-711s21c1
Sequence:CCGGTATGACAACTTAGTCTCATTGCTCGAGCAATGAGACTAAGTTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2222s21c1
Sequence:CCGGTAGGTTCATTTCTGTACTTAACTCGAGTTAAGTACAGAAATGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1214s21c1
Sequence:CCGGTAGGACTAGCCGTCAACTTACCTCGAGGTAAGTTGACGGCTAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-2725s21c1
Sequence:CCGGACATTGTGTCAATGGATTTATCTCGAGATAAATCCATTGACACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2514s21c1
Sequence:CCGGGCTGATGGAAATCCCTATATGCTCGAGCATATAGGGATTTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032689
ZNF607 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 607
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-958s1c1
Sequence:CCGGGCCTTTAGTGTATCTGGACAACTCGAGTTGTCCAGATACACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1145s1c1
Sequence:CCGGGCCTCATATATCATGACCGAACTCGAGTTCGGTCATGATATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-730s1c1
Sequence:CCGGGCCCATCATAACAGAATTCATCTCGAGATGAATTCTGTTATGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-479s1c1
Sequence:CCGGCTGCACCTCATACATTTGAAACTCGAGTTTCAAATGTATGAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1457s1c1
Sequence:CCGGGAAGGTCCTTTAGGCTTAGATCTCGAGATCTAAGCCTAAAGGACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1792s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAATTCTCGAGAATTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1372s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAAAGCTCGAGCTTTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-3105s21c1
Sequence:CCGGGATGATGGGAAAGGCTATTTACTCGAGTAAATAGCCTTTCCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-742s21c1
Sequence:CCGGCCGTATCTAAGCCAGATTTAACTCGAGTTAAATCTGGCTTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2392s21c1
Sequence:CCGGGTCATGCTTCACATCTTATTACTCGAGTAATAAGATGTGAAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-711s21c1
Sequence:CCGGTATGACAACTTAGTCTCATTGCTCGAGCAATGAGACTAAGTTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2222s21c1
Sequence:CCGGTAGGTTCATTTCTGTACTTAACTCGAGTTAAGTACAGAAATGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1214s21c1
Sequence:CCGGTAGGACTAGCCGTCAACTTACCTCGAGGTAAGTTGACGGCTAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-2725s21c1
Sequence:CCGGACATTGTGTCAATGGATTTATCTCGAGATAAATCCATTGACACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2514s21c1
Sequence:CCGGGCTGATGGAAATCCCTATATGCTCGAGCATATAGGGATTTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032689
ZNF607 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 607
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-958s1c1
Sequence:CCGGGCCTTTAGTGTATCTGGACAACTCGAGTTGTCCAGATACACTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1145s1c1
Sequence:CCGGGCCTCATATATCATGACCGAACTCGAGTTCGGTCATGATATATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-730s1c1
Sequence:CCGGGCCCATCATAACAGAATTCATCTCGAGATGAATTCTGTTATGATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-479s1c1
Sequence:CCGGCTGCACCTCATACATTTGAAACTCGAGTTTCAAATGTATGAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032689.2-1457s1c1
Sequence:CCGGGAAGGTCCTTTAGGCTTAGATCTCGAGATCTAAGCCTAAAGGACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1792s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAATTCTCGAGAATTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1372s21c1
Sequence:CCGGGGAAGTCCTTTAGGCTCAAAGCTCGAGCTTTGAGCCTAAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-3105s21c1
Sequence:CCGGGATGATGGGAAAGGCTATTTACTCGAGTAAATAGCCTTTCCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-742s21c1
Sequence:CCGGCCGTATCTAAGCCAGATTTAACTCGAGTTAAATCTGGCTTAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2392s21c1
Sequence:CCGGGTCATGCTTCACATCTTATTACTCGAGTAATAAGATGTGAAGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-711s21c1
Sequence:CCGGTATGACAACTTAGTCTCATTGCTCGAGCAATGAGACTAAGTTGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2222s21c1
Sequence:CCGGTAGGTTCATTTCTGTACTTAACTCGAGTTAAGTACAGAAATGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-1214s21c1
Sequence:CCGGTAGGACTAGCCGTCAACTTACCTCGAGGTAAGTTGACGGCTAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032689.4-2725s21c1
Sequence:CCGGACATTGTGTCAATGGATTTATCTCGAGATAAATCCATTGACACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032689.4-2514s21c1
Sequence:CCGGGCTGATGGAAATCCCTATATGCTCGAGCATATAGGGATTTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks