EMAIL THIS PAGE TO A FRIEND

ZNF608

zinc finger protein 608

Synonyms: NY-REN-36
UniProtKB ID: Q9ULD9, A7E2W9, Q3SYM6, Q68D12, Q8IY05, Q9Y5A1
Gene ID:
naked mole-rat(101715611) zinc finger protein 608
domestic guinea pig(100717966) zinc finger protein 608
cow(509992) zinc finger protein 608
sheep(101109444) zinc finger protein 608
chicken(426810) zinc finger protein 608
dog(481484) zinc finger protein 608
Horse(100063853) zinc finger protein 608
domestic cat(101085523) zinc finger protein 608
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020747 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000081 MISSION® esiRNA esiRNA targeting human ZNF608 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020747 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179037 predicted 488
2 SASI_Hs02_00353856 predicted 2585
3 SASI_Hs01_00179038 predicted 3975
4 SASI_Hs01_00179039 predicted 4540
5 SASI_Hs01_00179040 predicted 2935
6 SASI_Hs01_00179041 predicted 567
7 SASI_Hs01_00179043 predicted 1063
8 SASI_Hs02_00353857 predicted 3419
9 SASI_Hs01_00179044 predicted 3025
10 SASI_Hs02_00353858 predicted 505
11 SASI_Hs01_00179035 predicted 3887
12 SASI_Hs01_00179036 predicted 2997
13 SASI_Hs01_00179042 predicted 3840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020747
ZNF608 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 608
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1665s1c1
Sequence:CCGGCTGAGGACAATAAGCCTGGAACTCGAGTTCCAGGCTTATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1243s1c1
Sequence:CCGGCAGTGTGAATTTGGAAGGGATCTCGAGATCCCTTCCAAATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-176s1c1
Sequence:CCGGGATACTTATGACAGTGGCGATCTCGAGATCGCCACTGTCATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-2140s1c1
Sequence:CCGGCCTTCCAGTAATCTCCAACATCTCGAGATGTTGGAGATTACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020747.1-5099s1c1
Sequence:CCGGCCTTGCATATCCTTCACATATCTCGAGATATGTGAAGGATATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020747
ZNF608 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 608
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1665s1c1
Sequence:CCGGCTGAGGACAATAAGCCTGGAACTCGAGTTCCAGGCTTATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1243s1c1
Sequence:CCGGCAGTGTGAATTTGGAAGGGATCTCGAGATCCCTTCCAAATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-176s1c1
Sequence:CCGGGATACTTATGACAGTGGCGATCTCGAGATCGCCACTGTCATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-2140s1c1
Sequence:CCGGCCTTCCAGTAATCTCCAACATCTCGAGATGTTGGAGATTACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020747.1-5099s1c1
Sequence:CCGGCCTTGCATATCCTTCACATATCTCGAGATATGTGAAGGATATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020747
ZNF608 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 608
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1665s1c1
Sequence:CCGGCTGAGGACAATAAGCCTGGAACTCGAGTTCCAGGCTTATTGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-1243s1c1
Sequence:CCGGCAGTGTGAATTTGGAAGGGATCTCGAGATCCCTTCCAAATTCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-176s1c1
Sequence:CCGGGATACTTATGACAGTGGCGATCTCGAGATCGCCACTGTCATAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020747.1-2140s1c1
Sequence:CCGGCCTTCCAGTAATCTCCAACATCTCGAGATGTTGGAGATTACTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020747.1-5099s1c1
Sequence:CCGGCCTTGCATATCCTTCACATATCTCGAGATATGTGAAGGATATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks