EMAIL THIS PAGE TO A FRIEND

ZNF610

zinc finger protein 610

Species: Human ZNF610(162963)
UniProtKB ID: Q8N9Z0, A8K4C3, Q86YH8, Q8NDS9
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173530 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368321 predicted 781
2 SASI_Hs01_00017325 predicted 1155
3 SASI_Hs02_00368322 predicted 1588
4 SASI_Hs01_00017326 predicted 1167
5 SASI_Hs01_00017327 predicted 1590
6 SASI_Hs01_00017328 predicted 620
7 SASI_Hs01_00017329 predicted 1419
8 SASI_Hs01_00017332 predicted 940
9 SASI_Hs01_00017333 predicted 946
10 SASI_Hs02_00368323 predicted 1336
11 SASI_Hs01_00017324 predicted 1344
12 SASI_Hs01_00017330 predicted 1433
13 SASI_Hs01_00017331 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173530
ZNF610 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 610
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-625s21c1
Sequence:CCGGATTCTGCAAAGTCAAGTTAAACTCGAGTTTAACTTGACTTTGCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1018s21c1
Sequence:CCGGGTCCGTGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-919s21c1
Sequence:CCGGGATCTTATTGATTTCCCATTACTCGAGTAATGGGAAATCAATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1449s21c1
Sequence:CCGGCCTTGCACGGCATCAAATAATCTCGAGATTATTTGATGCCGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1533s21c1
Sequence:CCGGCCTTATGGCCCATCTTCTAATCTCGAGATTAGAAGATGGGCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1341s21c1
Sequence:CCGGCAAGAACTTCAGGCACAAATTCTCGAGAATTTGTGCCTGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1605s1c1
Sequence:CCGGGCGCAAATTATACCTAACCAACTCGAGTTGGTTAGGTATAATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1175s1c1
Sequence:CCGGAGGTGTTTAATCGCAATTCAACTCGAGTTGAATTGCGATTAAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1424s1c1
Sequence:CCGGGCAAGGTCTTTAGTCTGCTTTCTCGAGAAAGCAGACTAAAGACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-699s1c1
Sequence:CCGGGAGCTGTGTATTGGGAAGCAACTCGAGTTGCTTCCCAATACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173530
ZNF610 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 610
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-625s21c1
Sequence:CCGGATTCTGCAAAGTCAAGTTAAACTCGAGTTTAACTTGACTTTGCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1018s21c1
Sequence:CCGGGTCCGTGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-919s21c1
Sequence:CCGGGATCTTATTGATTTCCCATTACTCGAGTAATGGGAAATCAATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1449s21c1
Sequence:CCGGCCTTGCACGGCATCAAATAATCTCGAGATTATTTGATGCCGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1533s21c1
Sequence:CCGGCCTTATGGCCCATCTTCTAATCTCGAGATTAGAAGATGGGCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1341s21c1
Sequence:CCGGCAAGAACTTCAGGCACAAATTCTCGAGAATTTGTGCCTGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1605s1c1
Sequence:CCGGGCGCAAATTATACCTAACCAACTCGAGTTGGTTAGGTATAATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1175s1c1
Sequence:CCGGAGGTGTTTAATCGCAATTCAACTCGAGTTGAATTGCGATTAAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1424s1c1
Sequence:CCGGGCAAGGTCTTTAGTCTGCTTTCTCGAGAAAGCAGACTAAAGACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-699s1c1
Sequence:CCGGGAGCTGTGTATTGGGAAGCAACTCGAGTTGCTTCCCAATACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173530
ZNF610 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 610
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-625s21c1
Sequence:CCGGATTCTGCAAAGTCAAGTTAAACTCGAGTTTAACTTGACTTTGCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1018s21c1
Sequence:CCGGGTCCGTGCAAGCCTTACTAACCTCGAGGTTAGTAAGGCTTGCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-919s21c1
Sequence:CCGGGATCTTATTGATTTCCCATTACTCGAGTAATGGGAAATCAATAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1449s21c1
Sequence:CCGGCCTTGCACGGCATCAAATAATCTCGAGATTATTTGATGCCGTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1533s21c1
Sequence:CCGGCCTTATGGCCCATCTTCTAATCTCGAGATTAGAAGATGGGCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173530.2-1341s21c1
Sequence:CCGGCAAGAACTTCAGGCACAAATTCTCGAGAATTTGTGCCTGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1605s1c1
Sequence:CCGGGCGCAAATTATACCTAACCAACTCGAGTTGGTTAGGTATAATTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1175s1c1
Sequence:CCGGAGGTGTTTAATCGCAATTCAACTCGAGTTGAATTGCGATTAAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-1424s1c1
Sequence:CCGGGCAAGGTCTTTAGTCTGCTTTCTCGAGAAAGCAGACTAAAGACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173530.1-699s1c1
Sequence:CCGGGAGCTGTGTATTGGGAAGCAACTCGAGTTGCTTCCCAATACACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks