EMAIL THIS PAGE TO A FRIEND

ZNF611

zinc finger protein 611

Species: Human ZNF611(81856)
UniProtKB ID: Q8N823, B3KRD5, Q69YG9
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030972 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030972 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033944 predicted 2468
2 SASI_Hs01_00033945 predicted 2270
3 SASI_Hs01_00033946 predicted 2525
4 SASI_Hs01_00033947 predicted 1384
5 SASI_Hs01_00033943 predicted 1303
6 SASI_Hs01_00033948 predicted 2471
7 SASI_Hs01_00033942 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030972
ZNF611 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 611
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-868s1c1
Sequence:CCGGCTAATGATGCTCCCTCAGTTTCTCGAGAAACTGAGGGAGCATCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1303s1c1
Sequence:CCGGCCCTTCTAATTGATAAGGCAACTCGAGTTGCCTTATCAATTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1734s1c1
Sequence:CCGGACTAGAATTGACTGTGGAGAACTCGAGTTCTCCACAGTCAATTCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-2296s1c1
Sequence:CCGGTGCGTAATTCACTCCTGTCAACTCGAGTTGACAGGAGTGAATTACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1893s1c1
Sequence:CCGGGAGACACATAAGATAGGTCATCTCGAGATGACCTATCTTATGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2794s21c1
Sequence:CCGGTCAGAGATCGTTCACATATTGCTCGAGCAATATGTGAACGATCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2534s21c1
Sequence:CCGGGACAAGACTTGGGAGTGATTCCTCGAGGAATCACTCCCAAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030972
ZNF611 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 611
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-868s1c1
Sequence:CCGGCTAATGATGCTCCCTCAGTTTCTCGAGAAACTGAGGGAGCATCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1303s1c1
Sequence:CCGGCCCTTCTAATTGATAAGGCAACTCGAGTTGCCTTATCAATTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1734s1c1
Sequence:CCGGACTAGAATTGACTGTGGAGAACTCGAGTTCTCCACAGTCAATTCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-2296s1c1
Sequence:CCGGTGCGTAATTCACTCCTGTCAACTCGAGTTGACAGGAGTGAATTACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1893s1c1
Sequence:CCGGGAGACACATAAGATAGGTCATCTCGAGATGACCTATCTTATGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2794s21c1
Sequence:CCGGTCAGAGATCGTTCACATATTGCTCGAGCAATATGTGAACGATCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2534s21c1
Sequence:CCGGGACAAGACTTGGGAGTGATTCCTCGAGGAATCACTCCCAAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030972
ZNF611 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 611
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-868s1c1
Sequence:CCGGCTAATGATGCTCCCTCAGTTTCTCGAGAAACTGAGGGAGCATCATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1303s1c1
Sequence:CCGGCCCTTCTAATTGATAAGGCAACTCGAGTTGCCTTATCAATTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1734s1c1
Sequence:CCGGACTAGAATTGACTGTGGAGAACTCGAGTTCTCCACAGTCAATTCTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-2296s1c1
Sequence:CCGGTGCGTAATTCACTCCTGTCAACTCGAGTTGACAGGAGTGAATTACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030972.2-1893s1c1
Sequence:CCGGGAGACACATAAGATAGGTCATCTCGAGATGACCTATCTTATGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2794s21c1
Sequence:CCGGTCAGAGATCGTTCACATATTGCTCGAGCAATATGTGAACGATCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030972.3-2534s21c1
Sequence:CCGGGACAAGACTTGGGAGTGATTCCTCGAGGAATCACTCCCAAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks