EMAIL THIS PAGE TO A FRIEND

ZNF613

zinc finger protein 613

UniProtKB ID: Q6PF04, Q96SS9
Gene ID:
domestic cat(101092219) zinc finger protein 613
Horse(100065289) zinc finger protein 613
dog(611669) zinc finger protein 613
Domestic Rabbit(100353318) zinc finger protein 613
naked mole-rat(101705264) zinc finger protein 613
domestic guinea pig(100734885) zinc finger protein 613
cow(100125304) zinc finger protein 613
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031721 Rosetta Predictions human pricing
NM_024840 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162637 predicted 1956
2 SASI_Hs01_00162638 predicted 1657
3 SASI_Hs01_00162639 predicted 1990
4 SASI_Hs01_00162640 predicted 1318
5 SASI_Hs01_00162641 predicted 1893
6 SASI_Hs01_00162642 predicted 1143
7 SASI_Hs01_00162643 predicted 1063
8 SASI_Hs01_00162645 predicted 1216
9 SASI_Hs01_00162644 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013142 predicted 1897
2 SASI_Hs01_00013143 predicted 1595
3 SASI_Hs01_00013144 predicted 1919
4 SASI_Hs01_00013145 predicted 1250
5 SASI_Hs01_00013146 predicted 1823
6 SASI_Hs01_00013147 predicted 1076
7 SASI_Hs01_00013148 predicted 994
8 SASI_Hs01_00013150 predicted 1146
9 SASI_Hs01_00013149 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024840
ZNF613 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 613
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-1466s21c1
Sequence:CCGGGTCATATATATGCCGTGATTGCTCGAGCAATCACGGCATATATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-2012s21c1
Sequence:CCGGGAGTCATAGCTTATCACATACCTCGAGGTATGTGATAAGCTATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-652s21c1
Sequence:CCGGGAGTGGAACAATGCCATAAACCTCGAGGTTTATGGCATTGTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1164s1c1
Sequence:CCGGCGCTGGAAATCACAGCTCAATCTCGAGATTGAGCTGTGATTTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-2034s1c1
Sequence:CCGGCGTGATCTCATACAGGATAAACTCGAGTTTATCCTGTATGAGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-678s1c1
Sequence:CCGGGCATTTGGAAACATCATTCATCTCGAGATGAATGATGTTTCCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-893s1c1
Sequence:CCGGCGAAGGTGGAAATTCTGTGAACTCGAGTTCACAGAATTTCCACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1922s1c1
Sequence:CCGGCCACTTGTCATGCCTTGTTTACTCGAGTAAACAAGGCATGACAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024840
ZNF613 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 613
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-1466s21c1
Sequence:CCGGGTCATATATATGCCGTGATTGCTCGAGCAATCACGGCATATATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-2012s21c1
Sequence:CCGGGAGTCATAGCTTATCACATACCTCGAGGTATGTGATAAGCTATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-652s21c1
Sequence:CCGGGAGTGGAACAATGCCATAAACCTCGAGGTTTATGGCATTGTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1164s1c1
Sequence:CCGGCGCTGGAAATCACAGCTCAATCTCGAGATTGAGCTGTGATTTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-2034s1c1
Sequence:CCGGCGTGATCTCATACAGGATAAACTCGAGTTTATCCTGTATGAGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-678s1c1
Sequence:CCGGGCATTTGGAAACATCATTCATCTCGAGATGAATGATGTTTCCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-893s1c1
Sequence:CCGGCGAAGGTGGAAATTCTGTGAACTCGAGTTCACAGAATTTCCACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1922s1c1
Sequence:CCGGCCACTTGTCATGCCTTGTTTACTCGAGTAAACAAGGCATGACAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024840
ZNF613 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 613
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-1466s21c1
Sequence:CCGGGTCATATATATGCCGTGATTGCTCGAGCAATCACGGCATATATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-2012s21c1
Sequence:CCGGGAGTCATAGCTTATCACATACCTCGAGGTATGTGATAAGCTATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024840.3-652s21c1
Sequence:CCGGGAGTGGAACAATGCCATAAACCTCGAGGTTTATGGCATTGTTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1164s1c1
Sequence:CCGGCGCTGGAAATCACAGCTCAATCTCGAGATTGAGCTGTGATTTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-2034s1c1
Sequence:CCGGCGTGATCTCATACAGGATAAACTCGAGTTTATCCTGTATGAGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-678s1c1
Sequence:CCGGGCATTTGGAAACATCATTCATCTCGAGATGAATGATGTTTCCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-893s1c1
Sequence:CCGGCGAAGGTGGAAATTCTGTGAACTCGAGTTCACAGAATTTCCACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024840.2-1922s1c1
Sequence:CCGGCCACTTGTCATGCCTTGTTTACTCGAGTAAACAAGGCATGACAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks