EMAIL THIS PAGE TO A FRIEND

ZNF614

zinc finger protein 614

UniProtKB ID: Q8N883, Q494T8, Q8TCF4
Gene ID:
cow(100137855) zinc finger protein 614
sheep(101104087) zinc finger protein 614
dog(484338) zinc finger protein 614
domestic cat(101091982) zinc finger protein 614
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025040 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125674 predicted 1063
2 SASI_Hs01_00125675 predicted 2113
3 SASI_Hs01_00125676 predicted 1307
4 SASI_Hs01_00125677 predicted 844
5 SASI_Hs01_00125678 predicted 453
6 SASI_Hs02_00357694 predicted 1559
7 SASI_Hs01_00125680 predicted 2187
8 SASI_Hs01_00125681 predicted 2032
9 SASI_Hs01_00125682 predicted 1982
10 SASI_Hs01_00125683 predicted 1390
11 SASI_Hs01_00125679 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025040
ZNF614 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 614
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-897s1c1
Sequence:CCGGCCATACTAAATTCCAAGTCTTCTCGAGAAGACTTGGAATTTAGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1072s1c1
Sequence:CCGGCTGTTCACTAAGCATCTGAAACTCGAGTTTCAGATGCTTAGTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-642s1c1
Sequence:CCGGGCAGCAATGCAATGGACAGAACTCGAGTTCTGTCCATTGCATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1986s1c1
Sequence:CCGGCCACTTATCAAACCTTGTCAACTCGAGTTGACAAGGTTTGATAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-454s1c1
Sequence:CCGGGAGAACTATAACCACCTAGTACTCGAGTACTAGGTGGTTATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-847s21c1
Sequence:CCGGCATGAACGTACGCATACTAAACTCGAGTTTAGTATGCGTACGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-456s21c1
Sequence:GTACCGGGAACTATAACCACCTAGTATCCTCGAGGATACTAGGTGGTTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025040.2-3552s21c1
Sequence:CCGGTTGTGGAGTCTGCACTAATTTCTCGAGAAATTAGTGCAGACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1567s21c1
Sequence:CCGGGTCAAACGCACTCTCGTTATACTCGAGTATAACGAGAGTGCGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1227s21c1
Sequence:CCGGTACAATGAAGCGCTATCTAATCTCGAGATTAGATAGCGCTTCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025040
ZNF614 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 614
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-897s1c1
Sequence:CCGGCCATACTAAATTCCAAGTCTTCTCGAGAAGACTTGGAATTTAGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1072s1c1
Sequence:CCGGCTGTTCACTAAGCATCTGAAACTCGAGTTTCAGATGCTTAGTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-642s1c1
Sequence:CCGGGCAGCAATGCAATGGACAGAACTCGAGTTCTGTCCATTGCATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1986s1c1
Sequence:CCGGCCACTTATCAAACCTTGTCAACTCGAGTTGACAAGGTTTGATAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-454s1c1
Sequence:CCGGGAGAACTATAACCACCTAGTACTCGAGTACTAGGTGGTTATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-847s21c1
Sequence:CCGGCATGAACGTACGCATACTAAACTCGAGTTTAGTATGCGTACGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-456s21c1
Sequence:GTACCGGGAACTATAACCACCTAGTATCCTCGAGGATACTAGGTGGTTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025040.2-3552s21c1
Sequence:CCGGTTGTGGAGTCTGCACTAATTTCTCGAGAAATTAGTGCAGACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1567s21c1
Sequence:CCGGGTCAAACGCACTCTCGTTATACTCGAGTATAACGAGAGTGCGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1227s21c1
Sequence:CCGGTACAATGAAGCGCTATCTAATCTCGAGATTAGATAGCGCTTCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025040
ZNF614 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 614
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-897s1c1
Sequence:CCGGCCATACTAAATTCCAAGTCTTCTCGAGAAGACTTGGAATTTAGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1072s1c1
Sequence:CCGGCTGTTCACTAAGCATCTGAAACTCGAGTTTCAGATGCTTAGTGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-642s1c1
Sequence:CCGGGCAGCAATGCAATGGACAGAACTCGAGTTCTGTCCATTGCATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-1986s1c1
Sequence:CCGGCCACTTATCAAACCTTGTCAACTCGAGTTGACAAGGTTTGATAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025040.2-454s1c1
Sequence:CCGGGAGAACTATAACCACCTAGTACTCGAGTACTAGGTGGTTATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-847s21c1
Sequence:CCGGCATGAACGTACGCATACTAAACTCGAGTTTAGTATGCGTACGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-456s21c1
Sequence:GTACCGGGAACTATAACCACCTAGTATCCTCGAGGATACTAGGTGGTTATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025040.2-3552s21c1
Sequence:CCGGTTGTGGAGTCTGCACTAATTTCTCGAGAAATTAGTGCAGACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1567s21c1
Sequence:CCGGGTCAAACGCACTCTCGTTATACTCGAGTATAACGAGAGTGCGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025040.2-1227s21c1
Sequence:CCGGTACAATGAAGCGCTATCTAATCTCGAGATTAGATAGCGCTTCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks