EMAIL THIS PAGE TO A FRIEND

ZNF615

zinc finger protein 615

UniProtKB ID: Q8N8J6, B7ZKW9, Q2M2Y6, Q5CZB0, Q6ZMT7, Q6ZRB3
Gene ID:
dog(100685226) zinc finger protein 615
Horse(100064988) zinc finger protein 615
domestic cat(101084244) zinc finger protein 615
cow(101902702) zinc finger protein 615
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187825 predicted 1145
2 SASI_Hs01_00187826 predicted 2229
3 SASI_Hs01_00187827 predicted 1865
4 SASI_Hs02_00372023 predicted 1428
5 SASI_Hs01_00187829 predicted 821
6 SASI_Hs01_00187830 predicted 746
7 SASI_Hs01_00187831 predicted 1763
8 SASI_Hs01_00187832 predicted 1659
9 SASI_Hs01_00187833 predicted 490
10 SASI_Hs01_00187834 predicted 1585
11 SASI_Hs01_00187828 predicted 2560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198480
ZNF615 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 615
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2687s21c1
Sequence:CCGGATGAATGTGGCAGACTATAAACTCGAGTTTATAGTCTGCCACATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198480.2-850s21c1
Sequence:CCGGTAATAAGTCCCAGTTCATTAACTCGAGTTAATGAACTGGGACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2904s21c1
Sequence:CCGGCATCGTGTGCTAGGAAATAATCTCGAGATTATTTCCTAGCACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198480.2-3470s1c1
Sequence:CCGGCCCAGCTTCTTCCAAAGATAACTCGAGTTATCTTTGGAAGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1855s1c1
Sequence:CCGGTCCAGCAAAGATCCGGCTAATCTCGAGATTAGCCGGATCTTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1196s1c1
Sequence:CCGGCGGCTCATTTATCATCAACGACTCGAGTCGTTGATGATAAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1050s1c1
Sequence:CCGGCTCATACAGAACTGAAACATTCTCGAGAATGTTTCAGTTCTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-502s1c1
Sequence:CCGGAGATGAAATCTACTCTCGAATCTCGAGATTCGAGAGTAGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198480
ZNF615 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 615
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2687s21c1
Sequence:CCGGATGAATGTGGCAGACTATAAACTCGAGTTTATAGTCTGCCACATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198480.2-850s21c1
Sequence:CCGGTAATAAGTCCCAGTTCATTAACTCGAGTTAATGAACTGGGACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2904s21c1
Sequence:CCGGCATCGTGTGCTAGGAAATAATCTCGAGATTATTTCCTAGCACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198480.2-3470s1c1
Sequence:CCGGCCCAGCTTCTTCCAAAGATAACTCGAGTTATCTTTGGAAGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1855s1c1
Sequence:CCGGTCCAGCAAAGATCCGGCTAATCTCGAGATTAGCCGGATCTTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1196s1c1
Sequence:CCGGCGGCTCATTTATCATCAACGACTCGAGTCGTTGATGATAAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1050s1c1
Sequence:CCGGCTCATACAGAACTGAAACATTCTCGAGAATGTTTCAGTTCTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-502s1c1
Sequence:CCGGAGATGAAATCTACTCTCGAATCTCGAGATTCGAGAGTAGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198480
ZNF615 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 615
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2687s21c1
Sequence:CCGGATGAATGTGGCAGACTATAAACTCGAGTTTATAGTCTGCCACATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198480.2-850s21c1
Sequence:CCGGTAATAAGTCCCAGTTCATTAACTCGAGTTAATGAACTGGGACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198480.2-2904s21c1
Sequence:CCGGCATCGTGTGCTAGGAAATAATCTCGAGATTATTTCCTAGCACACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198480.2-3470s1c1
Sequence:CCGGCCCAGCTTCTTCCAAAGATAACTCGAGTTATCTTTGGAAGAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1855s1c1
Sequence:CCGGTCCAGCAAAGATCCGGCTAATCTCGAGATTAGCCGGATCTTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1196s1c1
Sequence:CCGGCGGCTCATTTATCATCAACGACTCGAGTCGTTGATGATAAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-1050s1c1
Sequence:CCGGCTCATACAGAACTGAAACATTCTCGAGAATGTTTCAGTTCTGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198480.2-502s1c1
Sequence:CCGGAGATGAAATCTACTCTCGAATCTCGAGATTCGAGAGTAGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks