EMAIL THIS PAGE TO A FRIEND

ZNF616

zinc finger protein 616

Species: Human ZNF616(90317)
UniProtKB ID: Q08AN1, B3KRV1, Q0P658, Q658V7
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178523 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142051 MISSION® esiRNA esiRNA human ZNF616 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178523 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369766 predicted 1362
2 SASI_Hs02_00369767 predicted 966
3 SASI_Hs01_00023052 predicted 783
4 SASI_Hs01_00023053 predicted 968
5 SASI_Hs02_00369768 predicted 289
6 SASI_Hs01_00023054 predicted 2361
7 SASI_Hs01_00023055 predicted 1297
8 SASI_Hs01_00023058 predicted 1965
9 SASI_Hs02_00369769 predicted 703
10 SASI_Hs01_00023060 predicted 446
11 SASI_Hs01_00023051 predicted 1290
12 SASI_Hs01_00023056 predicted 1367
13 SASI_Hs01_00023057 predicted 1368
14 SASI_Hs01_00023059 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178523
ZNF616 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 616
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178523.3-2713s1c1
Sequence:CCGGGTGGAATTGTAATCTCCAGTACTCGAGTACTGGAGATTACAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-2036s1c1
Sequence:CCGGGTCTACAGTCAGTATTCACATCTCGAGATGTGAATACTGACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-506s1c1
Sequence:CCGGGAAAGACATCAAAGCTATGATCTCGAGATCATAGCTTTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-1359s1c1
Sequence:CCGGGCAAGGCATTCAGACATAGATCTCGAGATCTATGTCTGAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-2560s21c1
Sequence:CCGGCCTCACTAAACATCGAATAAGCTCGAGCTTATTCGATGTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-1364s21c1
Sequence:GTACCGGGCATTCAGACATAGATCAAATCTCGAGATTTGATCTATGTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-779s21c1
Sequence:GTACCGGACGGAGAAGACAGGTAATAATCTCGAGATTATTACCTGTCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178523.3-2642s21c1
Sequence:CCGGTTTCTGGAATCACCGAATAATCTCGAGATTATTCGGTGATTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178523
ZNF616 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 616
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178523.3-2713s1c1
Sequence:CCGGGTGGAATTGTAATCTCCAGTACTCGAGTACTGGAGATTACAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-2036s1c1
Sequence:CCGGGTCTACAGTCAGTATTCACATCTCGAGATGTGAATACTGACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-506s1c1
Sequence:CCGGGAAAGACATCAAAGCTATGATCTCGAGATCATAGCTTTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-1359s1c1
Sequence:CCGGGCAAGGCATTCAGACATAGATCTCGAGATCTATGTCTGAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-2560s21c1
Sequence:CCGGCCTCACTAAACATCGAATAAGCTCGAGCTTATTCGATGTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-1364s21c1
Sequence:GTACCGGGCATTCAGACATAGATCAAATCTCGAGATTTGATCTATGTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-779s21c1
Sequence:GTACCGGACGGAGAAGACAGGTAATAATCTCGAGATTATTACCTGTCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178523.3-2642s21c1
Sequence:CCGGTTTCTGGAATCACCGAATAATCTCGAGATTATTCGGTGATTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178523
ZNF616 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 616
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178523.3-2713s1c1
Sequence:CCGGGTGGAATTGTAATCTCCAGTACTCGAGTACTGGAGATTACAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-2036s1c1
Sequence:CCGGGTCTACAGTCAGTATTCACATCTCGAGATGTGAATACTGACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-506s1c1
Sequence:CCGGGAAAGACATCAAAGCTATGATCTCGAGATCATAGCTTTGATGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178523.3-1359s1c1
Sequence:CCGGGCAAGGCATTCAGACATAGATCTCGAGATCTATGTCTGAATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-2560s21c1
Sequence:CCGGCCTCACTAAACATCGAATAAGCTCGAGCTTATTCGATGTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-1364s21c1
Sequence:GTACCGGGCATTCAGACATAGATCAAATCTCGAGATTTGATCTATGTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178523.3-779s21c1
Sequence:GTACCGGACGGAGAAGACAGGTAATAATCTCGAGATTATTACCTGTCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178523.3-2642s21c1
Sequence:CCGGTTTCTGGAATCACCGAATAATCTCGAGATTATTCGGTGATTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks